EMAIL THIS PAGE TO A FRIEND

PDE2A

phosphodiesterase 2A, cGMP-stimulated

162 Gene Product Result for
Synonyms: CGS-PDE PDE2A1 PED2A4 cGSPDE
UniProtKB ID: O00408, E9PGI1, Q5J793
Gene ID:
Mouse(207728) phosphodiesterase 2A, cGMP-stimulated
Rat(81743) phosphodiesterase 2A, cGMP-stimulated
dog(609574) phosphodiesterase 2A, cGMP-stimulated
Horse(100052619) phosphodiesterase 2A, cGMP-stimulated
domestic cat(101083366) phosphodiesterase 2A, cGMP-stimulated
Domestic Rabbit(100337951) phosphodiesterase 2A, cGMP-stimulated
naked mole-rat(101696343) phosphodiesterase 2A, cGMP-stimulated
domestic guinea pig(100713716) phosphodiesterase 2A, cGMP-stimulated
cow(281971) phosphodiesterase 2A, cGMP-stimulated
sheep(101122722) phosphodiesterase 2A, cGMP-stimulated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002599 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002599 Rosetta Predictions human pricing
NM_031079 Rosetta Predictions rat pricing
NM_001008548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190667 predicted 2030
2 SASI_Hs01_00190668 predicted 1446
3 SASI_Hs01_00190669 predicted 1583
4 SASI_Hs01_00190670 predicted 971
5 SASI_Hs01_00190671 predicted 1354
6 SASI_Hs01_00190672 predicted 1856
7 SASI_Hs01_00190673 predicted 981
8 SASI_Hs01_00190674 predicted 2735
9 SASI_Hs01_00190675 predicted 398
10 SASI_Hs01_00190676 predicted 2717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086768 predicted 297
2 SASI_Rn01_00086769 predicted 726
3 SASI_Rn01_00086770 predicted 677
4 SASI_Rn01_00086771 predicted 1193
5 SASI_Rn01_00086772 predicted 901
6 SASI_Rn01_00086773 predicted 2605
7 SASI_Rn01_00086774 predicted 2375
8 SASI_Rn01_00086775 predicted 1804
9 SASI_Rn01_00086777 predicted 2569
10 SASI_Rn02_00264320 predicted 1418
11 SASI_Rn01_00086776 predicted 2561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187338 predicted 509
2 SASI_Mm01_00187339 predicted 1908
3 SASI_Mm01_00187340 predicted 1637
4 SASI_Mm01_00187341 predicted 1294
5 SASI_Mm01_00187342 predicted 1269
6 SASI_Mm01_00187343 predicted 1404
7 SASI_Mm01_00187344 predicted 3085
8 SASI_Mm02_00286821 predicted 938
9 SASI_Mm01_00187345 predicted 2396
10 SASI_Mm02_00286822 predicted 457
11 SASI_Mm01_00187346 predicted 1900
12 SASI_Mm01_00187347 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008548
PDE2A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 2A, cGMP-stimulated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-1900s1c1
Sequence:CCGGGCCAATGAGATGATGATGTATCTCGAGATACATCATCATCTCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-634s1c1
Sequence:CCGGGACATGCAAGTGCTGGTCATACTCGAGTATGACCAGCACTTGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-2924s1c1
Sequence:CCGGCCAGTAACAACTCGCTGGATTCTCGAGAATCCAGCGAGTTGTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-2067s1c1
Sequence:CCGGGCTGCAAGACATGAACTTCATCTCGAGATGAAGTTCATGTCTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008548.1-3056s1c1
Sequence:CCGGCCCTCCTTTCACAACTCTCTACTCGAGTAGAGAGTTGTGAAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008548
PDE2A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 2A, cGMP-stimulated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-1900s1c1
Sequence:CCGGGCCAATGAGATGATGATGTATCTCGAGATACATCATCATCTCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-634s1c1
Sequence:CCGGGACATGCAAGTGCTGGTCATACTCGAGTATGACCAGCACTTGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-2924s1c1
Sequence:CCGGCCAGTAACAACTCGCTGGATTCTCGAGAATCCAGCGAGTTGTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-2067s1c1
Sequence:CCGGGCTGCAAGACATGAACTTCATCTCGAGATGAAGTTCATGTCTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008548.1-3056s1c1
Sequence:CCGGCCCTCCTTTCACAACTCTCTACTCGAGTAGAGAGTTGTGAAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008548
PDE2A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 2A, cGMP-stimulated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-1900s1c1
Sequence:CCGGGCCAATGAGATGATGATGTATCTCGAGATACATCATCATCTCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-634s1c1
Sequence:CCGGGACATGCAAGTGCTGGTCATACTCGAGTATGACCAGCACTTGCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-2924s1c1
Sequence:CCGGCCAGTAACAACTCGCTGGATTCTCGAGAATCCAGCGAGTTGTTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008548.1-2067s1c1
Sequence:CCGGGCTGCAAGACATGAACTTCATCTCGAGATGAAGTTCATGTCTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008548.1-3056s1c1
Sequence:CCGGCCCTCCTTTCACAACTCTCTACTCGAGTAGAGAGTTGTGAAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002599
PDE2A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 2A, cGMP-stimulated
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-396s1c1
Sequence:CCGGGAAACTGTCTACACCTACCTACTCGAGTAGGTAGGTGTAGACAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-2628s1c1
Sequence:CCGGGCGGAGCTGATCTACAAAGAACTCGAGTTCTTTGTAGATCAGCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-2030s1c1
Sequence:CCGGGCAGGACATGAATTTCATCAACTCGAGTTGATGAAATTCATGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-1310s1c1
Sequence:CCGGCCAGAAGGAACAGAAACTCAACTCGAGTTGAGTTTCTGTTCCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-1805s1c1
Sequence:CCGGCGCCCATTCTCTCCTATACAACTCGAGTTGTATAGGAGAGAATGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-1669s21c1
Sequence:CCGGCTGAACATCCCTGACGCATATCTCGAGATATGCGTCAGGGATGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-2469s21c1
Sequence:CCGGCTGCAACATCTTTGATCATTTCTCGAGAAATGATCAAAGATGTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-2360s21c1
Sequence:CCGGCTTTCCAGGTGGCCTCGAAATCTCGAGATTTCGAGGCCACCTGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002599
PDE2A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 2A, cGMP-stimulated
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-396s1c1
Sequence:CCGGGAAACTGTCTACACCTACCTACTCGAGTAGGTAGGTGTAGACAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-2628s1c1
Sequence:CCGGGCGGAGCTGATCTACAAAGAACTCGAGTTCTTTGTAGATCAGCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-2030s1c1
Sequence:CCGGGCAGGACATGAATTTCATCAACTCGAGTTGATGAAATTCATGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-1310s1c1
Sequence:CCGGCCAGAAGGAACAGAAACTCAACTCGAGTTGAGTTTCTGTTCCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-1805s1c1
Sequence:CCGGCGCCCATTCTCTCCTATACAACTCGAGTTGTATAGGAGAGAATGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-1669s21c1
Sequence:CCGGCTGAACATCCCTGACGCATATCTCGAGATATGCGTCAGGGATGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-2469s21c1
Sequence:CCGGCTGCAACATCTTTGATCATTTCTCGAGAAATGATCAAAGATGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-2360s21c1
Sequence:CCGGCTTTCCAGGTGGCCTCGAAATCTCGAGATTTCGAGGCCACCTGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002599
PDE2A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 2A, cGMP-stimulated
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-396s1c1
Sequence:CCGGGAAACTGTCTACACCTACCTACTCGAGTAGGTAGGTGTAGACAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-2628s1c1
Sequence:CCGGGCGGAGCTGATCTACAAAGAACTCGAGTTCTTTGTAGATCAGCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-2030s1c1
Sequence:CCGGGCAGGACATGAATTTCATCAACTCGAGTTGATGAAATTCATGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-1310s1c1
Sequence:CCGGCCAGAAGGAACAGAAACTCAACTCGAGTTGAGTTTCTGTTCCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002599.1-1805s1c1
Sequence:CCGGCGCCCATTCTCTCCTATACAACTCGAGTTGTATAGGAGAGAATGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-1669s21c1
Sequence:CCGGCTGAACATCCCTGACGCATATCTCGAGATATGCGTCAGGGATGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-2469s21c1
Sequence:CCGGCTGCAACATCTTTGATCATTTCTCGAGAAATGATCAAAGATGTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002599.3-2360s21c1
Sequence:CCGGCTTTCCAGGTGGCCTCGAAATCTCGAGATTTCGAGGCCACCTGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)