EMAIL THIS PAGE TO A FRIEND

PDE3A

phosphodiesterase 3A, cGMP-inhibited

123 Gene Product Result for
Synonyms: CGI-PDE CGI-PDE A CGI-PDE-A
UniProtKB ID: Q14432, O60865, Q13348, Q17RD1
Gene ID:
Human(5139) Summary: This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Mouse(54611) phosphodiesterase 3A, cGMP inhibited
Rat(50678) phosphodiesterase 3A, cGMP inhibited
Zebrafish(567051) phosphodiesterase 3A, cGMP-inhibited
Horse(100034086) phosphodiesterase 3A, cGMP-inhibited
domestic cat(101088586) phosphodiesterase 3A, cGMP-inhibited
chicken(418185) phosphodiesterase 3A, cGMP-inhibited
cow(536636) phosphodiesterase 3A, cGMP-inhibited
sheep(101115870) phosphodiesterase 3A, cGMP-inhibited
domestic guinea pig(100302667) phosphodiesterase 3A, cGMP inhibited
naked mole-rat(101704787) phosphodiesterase 3A, cGMP-inhibited
Domestic Rabbit(100009330) phosphodiesterase 3A, cGMP-inhibited
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D0633 7-(2,3-Dihydroxypropyl)theophylline human pricing
A1755 Aminophylline ≥98%, powder human pricing
1034308 Amrinone United States Pharmacopeia (USP) Reference Standard human pricing
C0737 Cilostazol ≥98% (HPLC), powder human pricing
PHR1503 Cilostazol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1134153 Cilostazol United States Pharmacopeia (USP) Reference Standard human pricing
D2800000 Diprophylline European Pharmacopoeia (EP) Reference Standard human pricing
D2850000 Dipyridamole European Pharmacopoeia (EP) Reference Standard human pricing
1220506 Dipyridamole United States Pharmacopeia (USP) Reference Standard human pricing
BP131 Dipyridamole British Pharmacopoeia (BP) Reference Standard human pricing
Y0000802 Dipyridamole for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
BP1102 Dipyridamole impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
1231502 Dyphylline United States Pharmacopeia (USP) Reference Standard human pricing
E1279 Enoximone solid human pricing
L5545 Levosimendan ≥98% (HPLC) human pricing
1443908 Milrinone United States Pharmacopeia (USP) Reference Standard human pricing
Q3504 Quazinone powder human pricing
PHR1023 Theophylline Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1653004 Theophylline certified reference material, United States Pharmacopeia (USP) Reference Standard human pricing
T0800000 Theophylline European Pharmacopoeia (EP) Reference Standard human pricing
PHL82668 Theophylline phyproof® Reference Substance human pricing
88308 Theophylline ≥99.0% (HPLC) human pricing
BP327 Theophylline British Pharmacopoeia (BP) Reference Standard human pricing
PHR1151 Theophylline melting point standard Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1653117 Theophylline melting point standard United States Pharmacopeia (USP) Reference Standard human pricing
IMPC-051-01 Theophylline solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T2057 Trequinsin hydrochloride ≥98% human pricing
D9766 Dipyridamole ≥98% (HPLC) human, mouse pricing
R6520 Rolipram solid, ≥98% (HPLC) human, mouse, rat pricing
T1633 Theophylline anhydrous, ≥99%, powder human, mouse, rat pricing
A4056 Amrinone human, rat pricing
C7971 Cilostamide phosphodiesterase inhibitor human, rat pricing
I0782 Imazodan ≥99% (HPLC) human, rat pricing
M4659 Milrinone ≥97% (TLC), powder human, rat pricing
Z3003 Zardaverine phosphodiesterase inhibitor human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000921 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000921 Rosetta Predictions human pricing
NM_017337 Rosetta Predictions rat pricing
NM_018779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195463 predicted 2861
2 SASI_Hs01_00195464 predicted 2703
3 SASI_Hs01_00195465 predicted 1709
4 SASI_Hs01_00195467 predicted 860
5 SASI_Hs01_00195468 predicted 3470
6 SASI_Hs01_00195471 predicted 2274
7 SASI_Hs01_00195472 predicted 2070
8 SASI_Hs02_00303498 predicted 654
9 SASI_Hs02_00303499 predicted 2696
10 SASI_Hs02_00303500 predicted 2008
11 SASI_Hs01_00195466 predicted 1684
12 SASI_Hs01_00195469 predicted 3452
13 SASI_Hs01_00195470 predicted 2597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097561 predicted 2386
2 SASI_Rn01_00097562 predicted 2139
3 SASI_Rn01_00097563 predicted 2359
4 SASI_Rn01_00097564 predicted 2192
5 SASI_Rn01_00097565 predicted 1837
6 SASI_Rn01_00097566 predicted 2985
7 SASI_Rn01_00097567 predicted 700
8 SASI_Rn01_00097568 predicted 2782
9 SASI_Rn01_00097569 predicted 2168
10 SASI_Rn02_00261794 predicted 2670
11 SASI_Rn01_00097570 predicted 2638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193960 predicted 3818
2 SASI_Mm01_00193961 predicted 3100
3 SASI_Mm01_00193962 predicted 2512
4 SASI_Mm01_00193963 predicted 2547
5 SASI_Mm02_00324088 predicted 2454
6 SASI_Mm01_00193964 predicted 3811
7 SASI_Mm01_00193965 predicted 1015
8 SASI_Mm01_00193966 predicted 3581
9 SASI_Mm01_00193967 predicted 1610
10 SASI_Mm01_00193968 predicted 3773
11 SASI_Mm01_00193969 predicted 2295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018779
PDE3A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 3A, cGMP-inhibited
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-3313s1c1
Sequence:CCGGGCCAATCTTCAGGAATCCTTTCTCGAGAAAGGATTCCTGAAGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-2457s1c1
Sequence:CCGGCCAGGTATCATACAGACTGTTCTCGAGAACAGTCTGTATGATACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-1948s1c1
Sequence:CCGGGCTTCACAACAGTTCCCAGAACTCGAGTTCTGGGAACTGTTGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-3314s1c1
Sequence:CCGGCCAATCTTCAGGAATCCTTTACTCGAGTAAAGGATTCCTGAAGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018779.1-3916s1c1
Sequence:CCGGCGCTGAAGACTCTAGCTCAAACTCGAGTTTGAGCTAGAGTCTTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018779
PDE3A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 3A, cGMP-inhibited
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-3313s1c1
Sequence:CCGGGCCAATCTTCAGGAATCCTTTCTCGAGAAAGGATTCCTGAAGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-2457s1c1
Sequence:CCGGCCAGGTATCATACAGACTGTTCTCGAGAACAGTCTGTATGATACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-1948s1c1
Sequence:CCGGGCTTCACAACAGTTCCCAGAACTCGAGTTCTGGGAACTGTTGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-3314s1c1
Sequence:CCGGCCAATCTTCAGGAATCCTTTACTCGAGTAAAGGATTCCTGAAGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018779.1-3916s1c1
Sequence:CCGGCGCTGAAGACTCTAGCTCAAACTCGAGTTTGAGCTAGAGTCTTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018779
PDE3A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 3A, cGMP-inhibited
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-3313s1c1
Sequence:CCGGGCCAATCTTCAGGAATCCTTTCTCGAGAAAGGATTCCTGAAGATTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-2457s1c1
Sequence:CCGGCCAGGTATCATACAGACTGTTCTCGAGAACAGTCTGTATGATACCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-1948s1c1
Sequence:CCGGGCTTCACAACAGTTCCCAGAACTCGAGTTCTGGGAACTGTTGTGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018779.1-3314s1c1
Sequence:CCGGCCAATCTTCAGGAATCCTTTACTCGAGTAAAGGATTCCTGAAGATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114981    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018779.1-3916s1c1
Sequence:CCGGCGCTGAAGACTCTAGCTCAAACTCGAGTTTGAGCTAGAGTCTTCAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000921
PDE3A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 3A, cGMP-inhibited
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000921.2-3768s1c1
Sequence:CCGGGCTCCACAATTTAGTAACATTCTCGAGAATGTTACTAAATTGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-1865s1c1
Sequence:CCGGCCTCTGATTATGAAACCAATACTCGAGTATTGGTTTCATAATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-3044s1c1
Sequence:CCGGCCTATGATTCAGCAGGACTAACTCGAGTTAGTCCTGCTGAATCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-2640s1c1
Sequence:CCGGGCCAGAGTATAACTTCTTAATCTCGAGATTAAGAAGTTATACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-2123s1c1
Sequence:CCGGGCCGTATTCTTAGTCAGGTATCTCGAGATACCTGACTAAGAATACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000921
PDE3A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 3A, cGMP-inhibited
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000921.2-3768s1c1
Sequence:CCGGGCTCCACAATTTAGTAACATTCTCGAGAATGTTACTAAATTGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-1865s1c1
Sequence:CCGGCCTCTGATTATGAAACCAATACTCGAGTATTGGTTTCATAATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-3044s1c1
Sequence:CCGGCCTATGATTCAGCAGGACTAACTCGAGTTAGTCCTGCTGAATCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-2640s1c1
Sequence:CCGGGCCAGAGTATAACTTCTTAATCTCGAGATTAAGAAGTTATACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-2123s1c1
Sequence:CCGGGCCGTATTCTTAGTCAGGTATCTCGAGATACCTGACTAAGAATACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000921
PDE3A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 3A, cGMP-inhibited
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000921.2-3768s1c1
Sequence:CCGGGCTCCACAATTTAGTAACATTCTCGAGAATGTTACTAAATTGTGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-1865s1c1
Sequence:CCGGCCTCTGATTATGAAACCAATACTCGAGTATTGGTTTCATAATCAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-3044s1c1
Sequence:CCGGCCTATGATTCAGCAGGACTAACTCGAGTTAGTCCTGCTGAATCATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-2640s1c1
Sequence:CCGGGCCAGAGTATAACTTCTTAATCTCGAGATTAAGAAGTTATACTCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000921.2-2123s1c1
Sequence:CCGGGCCGTATTCTTAGTCAGGTATCTCGAGATACCTGACTAAGAATACGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???