EMAIL THIS PAGE TO A FRIEND

PDE4A

phosphodiesterase 4A, cAMP-specific

186 Gene Product Result for
Synonyms: DPDE2 PDE4 PDE46
Gene ID:
Human(5141) Summary: The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Mouse(18577) phosphodiesterase 4A, cAMP specific
Rat(25638) phosphodiesterase 4A, cAMP-specific
Zebrafish(572061) phosphodiesterase 4A, cAMP-specific
chicken(769860) phosphodiesterase 4A, cAMP-specific
dog(100683695) phosphodiesterase 4A, cAMP-specific
domestic cat(751107) phosphodiesterase 4A, cAMP-specific
cow(512222) phosphodiesterase 4A, cAMP-specific
sheep(101117505) phosphodiesterase 4A, cAMP-specific
domestic guinea pig(100135594) phosphodiesterase 4A, cAMP-specific
naked mole-rat(101717168) phosphodiesterase 4A, cAMP-specific
Domestic Rabbit(100009247) phosphodiesterase 4A, cAMP-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D0633 7-(2,3-Dihydroxypropyl)theophylline human pricing
A1755 Aminophylline ≥98%, powder human pricing
SML0517 Amlexanox ≥98% (HPLC) human pricing
D2800000 Diprophylline European Pharmacopoeia (EP) Reference Standard human pricing
D2850000 Dipyridamole European Pharmacopoeia (EP) Reference Standard human pricing
BP131 Dipyridamole British Pharmacopoeia (BP) Reference Standard human pricing
1220506 Dipyridamole United States Pharmacopeia (USP) Reference Standard human pricing
Y0000802 Dipyridamole for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
BP1102 Dipyridamole impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
1231502 Dyphylline United States Pharmacopeia (USP) Reference Standard human pricing
Y0000736 Flavoxate hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP571 Flavoxate hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1270708 Flavoxate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F8304 Flavoxate hydrochloride ≥98% (HPLC), solid human pricing
I0157 Ibudilast ≥99% (HPLC), solid human pricing
SML1099 Roflumilast ≥98% (HPLC) human pricing
PHR1023 Theophylline Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1653004 Theophylline certified reference material, United States Pharmacopeia (USP) Reference Standard human pricing
PHL82668 Theophylline phyproof® Reference Substance human pricing
BP327 Theophylline British Pharmacopoeia (BP) Reference Standard human pricing
T0800000 Theophylline European Pharmacopoeia (EP) Reference Standard human pricing
PHR1151 Theophylline melting point standard Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1653117 Theophylline melting point standard United States Pharmacopeia (USP) Reference Standard human pricing
IMPC-051-01 Theophylline solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Z0878 Zaprinast solid human pricing
D9766 Dipyridamole ≥98% (HPLC) human, mouse pricing
R6520 Rolipram solid, ≥98% (HPLC) human, mouse, rat pricing
T1633 Theophylline anhydrous, ≥99%, powder human, mouse, rat pricing
B8279 4-(3-Butoxy-4-methoxybenzyl)imidazolidin-2-one solid human, rat pricing
C7971 Cilostamide phosphodiesterase inhibitor human, rat pricing
Z3003 Zardaverine phosphodiesterase inhibitor human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006202 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111307 Rosetta Predictions human pricing
NM_001111308 Rosetta Predictions human pricing
NM_001111309 Rosetta Predictions human pricing
NM_006202 Rosetta Predictions human pricing
NM_013101 Rosetta Predictions rat pricing
NM_019798 Rosetta Predictions mouse pricing
NM_183408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325344 predicted 2296
2 SASI_Hs02_00325345 predicted 1704
3 SASI_Hs02_00325346 predicted 1100
4 SASI_Hs02_00325347 predicted 2049
5 SASI_Hs02_00325348 predicted 2501
6 SASI_Hs02_00325349 predicted 2383
7 SASI_Hs02_00325350 predicted 2332
8 SASI_Hs02_00325351 predicted 1084
9 SASI_Hs02_00325352 predicted 1578
10 SASI_Hs02_00325353 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325354 predicted 1092
2 SASI_Hs02_00325355 predicted 2115
3 SASI_Hs02_00325356 predicted 1519
4 SASI_Hs02_00325357 predicted 918
5 SASI_Hs02_00325358 predicted 1867
6 SASI_Hs02_00325359 predicted 2314
7 SASI_Hs02_00325360 predicted 1198
8 SASI_Hs02_00325361 predicted 2197
9 SASI_Hs02_00325362 predicted 2138
10 SASI_Hs02_00325363 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325364 predicted 982
2 SASI_Hs02_00325365 predicted 2008
3 SASI_Hs02_00325366 predicted 1412
4 SASI_Hs02_00325367 predicted 810
5 SASI_Hs02_00325368 predicted 1765
6 SASI_Hs02_00325369 predicted 2215
7 SASI_Hs02_00325370 predicted 1090
8 SASI_Hs02_00325371 predicted 2088
9 SASI_Hs02_00325372 predicted 2036
10 SASI_Hs02_00325373 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341093 predicted 761
2 SASI_Hs02_00341094 predicted 1783
3 SASI_Hs01_00055084 predicted 1189
4 SASI_Hs01_00055085 predicted 580
5 SASI_Hs02_00341095 predicted 1535
6 SASI_Hs01_00055086 predicted 1989
7 SASI_Hs02_00341096 predicted 865
8 SASI_Hs02_00341097 predicted 1859
9 SASI_Hs02_00341098 predicted 1812
10 SASI_Hs01_00055088 predicted 570
11 SASI_Hs01_00055082 predicted 428
12 SASI_Hs01_00055083 predicted 1783
13 SASI_Hs01_00055087 predicted 616
14 SASI_Hs01_00055089 predicted 435
15 SASI_Hs01_00055090 predicted 383
16 SASI_Hs01_00055091 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048139 predicted 1502
2 SASI_Rn01_00048140 predicted 1641
3 SASI_Rn01_00048141 predicted 1572
4 SASI_Rn01_00048142 predicted 906
5 SASI_Rn01_00048143 predicted 1220
6 SASI_Rn01_00048144 predicted 887
7 SASI_Rn01_00048145 predicted 926
8 SASI_Rn01_00048146 predicted 1065
9 SASI_Rn01_00048147 predicted 644
10 SASI_Rn01_00048148 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036699 predicted 835
2 SASI_Mm02_00325032 predicted 1262
3 SASI_Mm02_00325033 predicted 1192
4 SASI_Mm01_00036701 predicted 689
5 SASI_Mm02_00325034 predicted 1821
6 SASI_Mm02_00325035 predicted 1927
7 SASI_Mm02_00325036 predicted 1596
8 SASI_Mm02_00325037 predicted 1589
9 SASI_Mm02_00325038 predicted 733
10 SASI_Mm02_00325039 predicted 2011
11 SASI_Mm01_00036697 predicted 1806
12 SASI_Mm01_00036698 predicted 501
13 SASI_Mm01_00036700 predicted 1700
14 SASI_Mm01_00036702 predicted 497
15 SASI_Mm01_00036703 predicted 511
16 SASI_Mm01_00036704 predicted 1680
17 SASI_Mm01_00036705 predicted 706
18 SASI_Mm01_00036706 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077297 predicted 1345
2 SASI_Mm02_00350509 predicted 1767
3 SASI_Mm02_00350510 predicted 1693
4 SASI_Mm01_00077299 predicted 1190
5 SASI_Mm02_00350511 predicted 2332
6 SASI_Mm02_00350512 predicted 2429
7 SASI_Mm02_00350513 predicted 2108
8 SASI_Mm02_00350514 predicted 2094
9 SASI_Mm02_00350515 predicted 1242
10 SASI_Mm02_00350516 predicted 2516
11 SASI_Mm01_00077295 predicted 2563
12 SASI_Mm01_00077296 predicted 1261
13 SASI_Mm01_00077298 predicted 2459
14 SASI_Mm01_00077300 predicted 1263
15 SASI_Mm01_00077301 predicted 1276
16 SASI_Mm01_00077302 predicted 2444
17 SASI_Mm01_00077303 predicted 1465
18 SASI_Mm01_00077304 predicted 1409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183408
PDE4A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4A, cAMP-specific
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-1006s21c1
Sequence:CCGGACTCACACACCTGTCGGAAATCTCGAGATTTCCGACAGGTGTGTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-2035s21c1
Sequence:CCGGGGAACGCGGAATGGAGATTAGCTCGAGCTAATCTCCATTCCGCGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-1349s21c1
Sequence:CCGGTGTATCATGTATACGATATTCCTCGAGGAATATCGTATACATGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-2443s1c1
Sequence:CCGGGCCATTCCTTCAGCCTTGAAACTCGAGTTTCAAGGCTGAAGGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183408.1-2720s1c1
Sequence:CCGGACTCACCACAGACCACCTCAACTCGAGTTGAGGTGGTCTGTGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-1637s1c1
Sequence:CCGGGCAAGAAGAGAACTGCGACATCTCGAGATGTCGCAGTTCTCTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-1155s1c1
Sequence:CCGGCGATTTGGAGTCAAGACAGATCTCGAGATCTGTCTTGACTCCAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-545s1c1
Sequence:CCGGGCGCCGAGAATCCTTCCTCTACTCGAGTAGAGGAAGGATTCTCGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183408
PDE4A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4A, cAMP-specific
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-1006s21c1
Sequence:CCGGACTCACACACCTGTCGGAAATCTCGAGATTTCCGACAGGTGTGTGAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-2035s21c1
Sequence:CCGGGGAACGCGGAATGGAGATTAGCTCGAGCTAATCTCCATTCCGCGTTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000417467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-1349s21c1
Sequence:CCGGTGTATCATGTATACGATATTCCTCGAGGAATATCGTATACATGATACATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000114963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-2443s1c1
Sequence:CCGGGCCATTCCTTCAGCCTTGAAACTCGAGTTTCAAGGCTGAAGGAATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000114961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183408.1-2720s1c1
Sequence:CCGGACTCACCACAGACCACCTCAACTCGAGTTGAGGTGGTCTGTGGTGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000114962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-1637s1c1
Sequence:CCGGGCAAGAAGAGAACTGCGACATCTCGAGATGTCGCAGTTCTCTTCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000114965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-1155s1c1
Sequence:CCGGCGATTTGGAGTCAAGACAGATCTCGAGATCTGTCTTGACTCCAAATCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000114964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-545s1c1
Sequence:CCGGGCGCCGAGAATCCTTCCTCTACTCGAGTAGAGGAAGGATTCTCGGCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183408
PDE4A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4A, cAMP-specific
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-1006s21c1
Sequence:CCGGACTCACACACCTGTCGGAAATCTCGAGATTTCCGACAGGTGTGTGAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-2035s21c1
Sequence:CCGGGGAACGCGGAATGGAGATTAGCTCGAGCTAATCTCCATTCCGCGTTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183408.3-1349s21c1
Sequence:CCGGTGTATCATGTATACGATATTCCTCGAGGAATATCGTATACATGATACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-2443s1c1
Sequence:CCGGGCCATTCCTTCAGCCTTGAAACTCGAGTTTCAAGGCTGAAGGAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183408.1-2720s1c1
Sequence:CCGGACTCACCACAGACCACCTCAACTCGAGTTGAGGTGGTCTGTGGTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-1637s1c1
Sequence:CCGGGCAAGAAGAGAACTGCGACATCTCGAGATGTCGCAGTTCTCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-1155s1c1
Sequence:CCGGCGATTTGGAGTCAAGACAGATCTCGAGATCTGTCTTGACTCCAAATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183408.1-545s1c1
Sequence:CCGGGCGCCGAGAATCCTTCCTCTACTCGAGTAGAGGAAGGATTCTCGGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006202
VALIDATED
PDE4A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4A, cAMP-specific
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-1906s21c1
Sequence:CCGGCGAGCTGGAGGCAGTGTATTTCTCGAGAAATACACTGCCTCCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-873s21c1
Sequence:CCGGCTGACGTGGCCTACCATAACACTCGAGTGTTATGGTAGGCCACGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-824s21c1
Sequence:CCGGGTGGACACGATGGTGACATACCTCGAGGTATGTCACCATCGTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006202.2-3332s21c1
Sequence:CCGGGGAAGCAATAATGGTGTATACCTCGAGGTATACACCATTATTGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-574s21c1
Sequence:CCGGCTTACAGCCCATGTCCCAAATCTCGAGATTTGGGACATGGGCTGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006202.1-3043s1c1
Sequence:CCGGCCTTCCACTTTGGGTTCACTTCTCGAGAAGTGAACCCAAAGTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-437s1c1
Sequence:CCGGCAGAGTACATTTCCACAACATCTCGAGATGTTGTGGAAATGTACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-612s1c1
Sequence:CCGGGCATAGTAACAGCCTGAACAACTCGAGTTGTTCAGGCTGTTACTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006202.1-1744s1c1
Sequence:CCGGGAAATATCAATGGCCCAGATACTCGAGTATCTGGGCCATTGATATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-1857s1c1
Sequence:CCGGCCAGGAGTCGTTGGAAGTTATCTCGAGATAACTTCCAACGACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006202
VALIDATED
PDE4A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4A, cAMP-specific
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-1906s21c1
Sequence:CCGGCGAGCTGGAGGCAGTGTATTTCTCGAGAAATACACTGCCTCCAGCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-873s21c1
Sequence:CCGGCTGACGTGGCCTACCATAACACTCGAGTGTTATGGTAGGCCACGTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-824s21c1
Sequence:CCGGGTGGACACGATGGTGACATACCTCGAGGTATGTCACCATCGTGTCCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006202.2-3332s21c1
Sequence:CCGGGGAAGCAATAATGGTGTATACCTCGAGGTATACACCATTATTGCTTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-574s21c1
Sequence:CCGGCTTACAGCCCATGTCCCAAATCTCGAGATTTGGGACATGGGCTGTAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000048808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006202.1-3043s1c1
Sequence:CCGGCCTTCCACTTTGGGTTCACTTCTCGAGAAGTGAACCCAAAGTGGAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000048811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-437s1c1
Sequence:CCGGCAGAGTACATTTCCACAACATCTCGAGATGTTGTGGAAATGTACTCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000048809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-612s1c1
Sequence:CCGGGCATAGTAACAGCCTGAACAACTCGAGTTGTTCAGGCTGTTACTATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000048810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006202.1-1744s1c1
Sequence:CCGGGAAATATCAATGGCCCAGATACTCGAGTATCTGGGCCATTGATATTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000048812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-1857s1c1
Sequence:CCGGCCAGGAGTCGTTGGAAGTTATCTCGAGATAACTTCCAACGACTCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006202
VALIDATED
PDE4A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4A, cAMP-specific
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-1906s21c1
Sequence:CCGGCGAGCTGGAGGCAGTGTATTTCTCGAGAAATACACTGCCTCCAGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-873s21c1
Sequence:CCGGCTGACGTGGCCTACCATAACACTCGAGTGTTATGGTAGGCCACGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-824s21c1
Sequence:CCGGGTGGACACGATGGTGACATACCTCGAGGTATGTCACCATCGTGTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006202.2-3332s21c1
Sequence:CCGGGGAAGCAATAATGGTGTATACCTCGAGGTATACACCATTATTGCTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006202.2-574s21c1
Sequence:CCGGCTTACAGCCCATGTCCCAAATCTCGAGATTTGGGACATGGGCTGTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006202.1-3043s1c1
Sequence:CCGGCCTTCCACTTTGGGTTCACTTCTCGAGAAGTGAACCCAAAGTGGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-437s1c1
Sequence:CCGGCAGAGTACATTTCCACAACATCTCGAGATGTTGTGGAAATGTACTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-612s1c1
Sequence:CCGGGCATAGTAACAGCCTGAACAACTCGAGTTGTTCAGGCTGTTACTATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006202.1-1744s1c1
Sequence:CCGGGAAATATCAATGGCCCAGATACTCGAGTATCTGGGCCATTGATATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006202.1-1857s1c1
Sequence:CCGGCCAGGAGTCGTTGGAAGTTATCTCGAGATAACTTCCAACGACTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)