EMAIL THIS PAGE TO A FRIEND

PDE4B

phosphodiesterase 4B, cAMP-specific

188 Gene Product Result for
Synonyms: DPDE4 PDE4B5 PDEIVB
UniProtKB ID: Q07343, O15443, Q13945, Q5TEK4, Q5TEK5, Q5TEK6
Gene ID:
Human(5142) Summary: This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. Cyclic nucleotides are important second messengers that regulate and mediate a number of cellular responses to extracellular signals, such as hormones, light, and neurotransmitters. The cyclic nucleotide phosphodiesterases (PDEs) regulate the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. This gene encodes a protein that specifically hydrolyzes cAMP. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(18578) phosphodiesterase 4B, cAMP specific
Rat(24626) phosphodiesterase 4B, cAMP specific
Domestic Rabbit(100355058) phosphodiesterase 4B, cAMP-specific
naked mole-rat(101703441) phosphodiesterase 4B, cAMP-specific
domestic guinea pig(100720296) phosphodiesterase 4B, cAMP-specific
cow(100124505) phosphodiesterase 4B, cAMP-specific
sheep(101111757) phosphodiesterase 4B, cAMP-specific
chicken(424700) phosphodiesterase 4B, cAMP-specific
Horse(100053961) phosphodiesterase 4B, cAMP-specific
domestic cat(101081316) phosphodiesterase 4B, cAMP-specific
dog(479540) phosphodiesterase 4B, cAMP-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002600 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037339 Rosetta Predictions human pricing
NM_001037340 Rosetta Predictions human pricing
NM_001037341 Rosetta Predictions human pricing
NM_002600 Rosetta Predictions human pricing
NM_017031 Rosetta Predictions rat pricing
NM_019840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064410 predicted 856
2 SASI_Hs01_00064411 predicted 1775
3 SASI_Hs02_00308287 predicted 1313
4 SASI_Hs01_00064412 predicted 1469
5 SASI_Hs01_00064413 predicted 924
6 SASI_Hs01_00064414 predicted 1397
7 SASI_Hs01_00064415 predicted 705
8 SASI_Hs01_00064416 predicted 1875
9 SASI_Hs01_00064418 predicted 1024
10 SASI_Hs01_00064419 predicted 593
11 SASI_Hs01_00064417 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204668 predicted 1241
2 SASI_Hs01_00204669 predicted 2165
3 SASI_Hs02_00308288 predicted 1700
4 SASI_Hs01_00204670 predicted 1865
5 SASI_Hs01_00204671 predicted 1322
6 SASI_Hs01_00204672 predicted 1791
7 SASI_Hs01_00204673 predicted 1093
8 SASI_Hs01_00204674 predicted 2268
9 SASI_Hs01_00204676 predicted 1412
10 SASI_Hs01_00204677 predicted 991
11 SASI_Hs01_00204675 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051348 predicted 1275
2 SASI_Hs01_00051349 predicted 2204
3 SASI_Hs02_00308289 predicted 1740
4 SASI_Hs01_00051350 predicted 1895
5 SASI_Hs01_00051351 predicted 1359
6 SASI_Hs01_00051352 predicted 1826
7 SASI_Hs01_00051353 predicted 1133
8 SASI_Hs01_00051354 predicted 2311
9 SASI_Hs01_00051356 predicted 1447
10 SASI_Hs01_00051357 predicted 1025
11 SASI_Hs01_00051355 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043470 predicted 1239
2 SASI_Hs01_00043471 predicted 2154
3 SASI_Hs02_00334111 predicted 1691
4 SASI_Hs01_00043472 predicted 1849
5 SASI_Hs01_00043473 predicted 1313
6 SASI_Hs01_00043474 predicted 1778
7 SASI_Hs01_00043475 predicted 1090
8 SASI_Hs01_00043476 predicted 2263
9 SASI_Hs01_00043478 predicted 1402
10 SASI_Hs01_00043479 predicted 980
11 SASI_Hs01_00043477 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060228 predicted 1905
2 SASI_Rn01_00060229 predicted 529
3 SASI_Rn01_00060230 predicted 2269
4 SASI_Rn01_00060231 predicted 2101
5 SASI_Rn01_00060232 predicted 1504
6 SASI_Rn01_00060233 predicted 2509
7 SASI_Rn01_00060234 predicted 1991
8 SASI_Rn02_00261208 predicted 1788
9 SASI_Rn01_00060235 predicted 1295
10 SASI_Rn01_00060237 predicted 1630
11 SASI_Rn01_00060236 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054410 predicted 1287
2 SASI_Mm01_00054411 predicted 1589
3 SASI_Mm01_00054412 predicted 1874
4 SASI_Mm01_00054413 predicted 1633
5 SASI_Mm01_00054414 predicted 2038
6 SASI_Mm01_00054415 predicted 903
7 SASI_Mm01_00054416 predicted 2356
8 SASI_Mm01_00054417 predicted 1611
9 SASI_Mm01_00054418 predicted 1068
10 SASI_Mm01_00054419 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019840
VALIDATED
PDE4B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4B, cAMP-specific
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-1337s1c1
Sequence:CCGGGTAACCTACATGATGACTTTACTCGAGTAAAGTCATCATGTAGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019840.1-2531s1c1
Sequence:CCGGGCCGTGAAGCAAATAGCAGTTCTCGAGAACTGCTATTTGCTTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-700s1c1
Sequence:CCGGGCGAAGTGTAAGAAACAACTTCTCGAGAAGTTGTTTCTTACACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-802s1c1
Sequence:CCGGGCAAGAGGAATCATATCAGAACTCGAGTTCTGATATGATTCCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-1090s1c1
Sequence:CCGGCCAGATAAGTGGAGTGAAGAACTCGAGTTCTTCACTCCACTTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-2323s21c1
Sequence:CCGGGGAGAAGGCCACAGCTATTTCCTCGAGGAAATAGCTGTGGCCTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-1673s21c1
Sequence:CCGGACCTTGCTGTGGGATTCAAATCTCGAGATTTGAATCCCACAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-1361s21c1
Sequence:CCGGGAGACCTTCTGAAGACGTTTACTCGAGTAAACGTCTTCAGAAGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019840.2-2782s21c1
Sequence:CCGGCACTAACAACTTCATCTATAACTCGAGTTATAGATGAAGTTGTTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-2140s21c1
Sequence:CCGGCAACCGGATGCTCAAGATATTCTCGAGAATATCTTGAGCATCCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019840
VALIDATED
PDE4B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4B, cAMP-specific
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-1337s1c1
Sequence:CCGGGTAACCTACATGATGACTTTACTCGAGTAAAGTCATCATGTAGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019840.1-2531s1c1
Sequence:CCGGGCCGTGAAGCAAATAGCAGTTCTCGAGAACTGCTATTTGCTTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-700s1c1
Sequence:CCGGGCGAAGTGTAAGAAACAACTTCTCGAGAAGTTGTTTCTTACACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-802s1c1
Sequence:CCGGGCAAGAGGAATCATATCAGAACTCGAGTTCTGATATGATTCCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-1090s1c1
Sequence:CCGGCCAGATAAGTGGAGTGAAGAACTCGAGTTCTTCACTCCACTTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-2323s21c1
Sequence:CCGGGGAGAAGGCCACAGCTATTTCCTCGAGGAAATAGCTGTGGCCTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-1673s21c1
Sequence:CCGGACCTTGCTGTGGGATTCAAATCTCGAGATTTGAATCCCACAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-1361s21c1
Sequence:CCGGGAGACCTTCTGAAGACGTTTACTCGAGTAAACGTCTTCAGAAGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019840.2-2782s21c1
Sequence:CCGGCACTAACAACTTCATCTATAACTCGAGTTATAGATGAAGTTGTTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-2140s21c1
Sequence:CCGGCAACCGGATGCTCAAGATATTCTCGAGAATATCTTGAGCATCCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019840
VALIDATED
PDE4B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4B, cAMP-specific
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-1337s1c1
Sequence:CCGGGTAACCTACATGATGACTTTACTCGAGTAAAGTCATCATGTAGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019840.1-2531s1c1
Sequence:CCGGGCCGTGAAGCAAATAGCAGTTCTCGAGAACTGCTATTTGCTTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-700s1c1
Sequence:CCGGGCGAAGTGTAAGAAACAACTTCTCGAGAAGTTGTTTCTTACACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-802s1c1
Sequence:CCGGGCAAGAGGAATCATATCAGAACTCGAGTTCTGATATGATTCCTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019840.1-1090s1c1
Sequence:CCGGCCAGATAAGTGGAGTGAAGAACTCGAGTTCTTCACTCCACTTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-2323s21c1
Sequence:CCGGGGAGAAGGCCACAGCTATTTCCTCGAGGAAATAGCTGTGGCCTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-1673s21c1
Sequence:CCGGACCTTGCTGTGGGATTCAAATCTCGAGATTTGAATCCCACAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-1361s21c1
Sequence:CCGGGAGACCTTCTGAAGACGTTTACTCGAGTAAACGTCTTCAGAAGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019840.2-2782s21c1
Sequence:CCGGCACTAACAACTTCATCTATAACTCGAGTTATAGATGAAGTTGTTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019840.2-2140s21c1
Sequence:CCGGCAACCGGATGCTCAAGATATTCTCGAGAATATCTTGAGCATCCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002600
PDE4B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4B, cAMP-specific
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1083s1c1
Sequence:CCGGGCATAGTTCAAGCCTAAACAACTCGAGTTGTTTAGGCTTGAACTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-525s1c1
Sequence:CCGGGCGCAGAGAGTCATTTCTCTACTCGAGTAGAGAAATGACTCTCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1266s1c1
Sequence:CCGGCCTCCTAAAGACATTCAGAATCTCGAGATTCTGAATGTCTTTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-206s1c1
Sequence:CCGGGCTTGAGTAAATCCTACAGTTCTCGAGAACTGTAGGATTTACTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1850s1c1
Sequence:CCGGCCTTGGAATTGTATCGGCAATCTCGAGATTGCCGATACAATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1311s21c1
Sequence:CCGGATAACCTACATGATGACTTTACTCGAGTAAAGTCATCATGTAGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002600.3-2688s21c1
Sequence:CCGGACTGAACTCACTGACTAATAACTCGAGTTATTAGTCAGTGAGTTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-340s21c1
Sequence:CCGGCTCCTGAGGGAGATGGTATTTCTCGAGAAATACCATCTCCCTCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1342s21c1
Sequence:CCGGACCATTCTGACGTGGCATATCCTCGAGGATATGCCACGTCAGAATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1241s21c1
Sequence:CCGGATGCATCATGTATGCTATATTCTCGAGAATATAGCATACATGATGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002600
PDE4B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4B, cAMP-specific
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1083s1c1
Sequence:CCGGGCATAGTTCAAGCCTAAACAACTCGAGTTGTTTAGGCTTGAACTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-525s1c1
Sequence:CCGGGCGCAGAGAGTCATTTCTCTACTCGAGTAGAGAAATGACTCTCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1266s1c1
Sequence:CCGGCCTCCTAAAGACATTCAGAATCTCGAGATTCTGAATGTCTTTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-206s1c1
Sequence:CCGGGCTTGAGTAAATCCTACAGTTCTCGAGAACTGTAGGATTTACTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1850s1c1
Sequence:CCGGCCTTGGAATTGTATCGGCAATCTCGAGATTGCCGATACAATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1311s21c1
Sequence:CCGGATAACCTACATGATGACTTTACTCGAGTAAAGTCATCATGTAGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002600.3-2688s21c1
Sequence:CCGGACTGAACTCACTGACTAATAACTCGAGTTATTAGTCAGTGAGTTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-340s21c1
Sequence:CCGGCTCCTGAGGGAGATGGTATTTCTCGAGAAATACCATCTCCCTCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1342s21c1
Sequence:CCGGACCATTCTGACGTGGCATATCCTCGAGGATATGCCACGTCAGAATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1241s21c1
Sequence:CCGGATGCATCATGTATGCTATATTCTCGAGAATATAGCATACATGATGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002600
PDE4B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4B, cAMP-specific
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1083s1c1
Sequence:CCGGGCATAGTTCAAGCCTAAACAACTCGAGTTGTTTAGGCTTGAACTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-525s1c1
Sequence:CCGGGCGCAGAGAGTCATTTCTCTACTCGAGTAGAGAAATGACTCTCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1266s1c1
Sequence:CCGGCCTCCTAAAGACATTCAGAATCTCGAGATTCTGAATGTCTTTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-206s1c1
Sequence:CCGGGCTTGAGTAAATCCTACAGTTCTCGAGAACTGTAGGATTTACTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002600.2-1850s1c1
Sequence:CCGGCCTTGGAATTGTATCGGCAATCTCGAGATTGCCGATACAATTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1311s21c1
Sequence:CCGGATAACCTACATGATGACTTTACTCGAGTAAAGTCATCATGTAGGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002600.3-2688s21c1
Sequence:CCGGACTGAACTCACTGACTAATAACTCGAGTTATTAGTCAGTGAGTTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-340s21c1
Sequence:CCGGCTCCTGAGGGAGATGGTATTTCTCGAGAAATACCATCTCCCTCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1342s21c1
Sequence:CCGGACCATTCTGACGTGGCATATCCTCGAGGATATGCCACGTCAGAATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002600.3-1241s21c1
Sequence:CCGGATGCATCATGTATGCTATATTCTCGAGAATATAGCATACATGATGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)