EMAIL THIS PAGE TO A FRIEND

PDE4C

phosphodiesterase 4C, cAMP-specific

103 Gene Product Result for
Synonyms: DPDE1
UniProtKB ID: Q08493, B3KTC4, Q9UN44, Q9UN45, Q9UN46, Q9UPJ6
Gene ID:
Human(5143) Summary: The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Mouse(110385) phosphodiesterase 4C, cAMP specific
Rat(290646) phosphodiesterase 4C, cAMP-specific
dog(609938) phosphodiesterase 4C, cAMP-specific
domestic cat(101086123) phosphodiesterase 4C, cAMP-specific
cow(524624) phosphodiesterase 4C, cAMP-specific
sheep(101111282) phosphodiesterase 4C, cAMP-specific
naked mole-rat(101703048) phosphodiesterase 4C, cAMP-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D0633 7-(2,3-Dihydroxypropyl)theophylline human pricing
A1755 Aminophylline ≥98%, powder human pricing
SML0517 Amlexanox ≥98% (HPLC) human pricing
1029308 Amlexanox United States Pharmacopeia (USP) Reference Standard human pricing
D2800000 Diprophylline European Pharmacopoeia (EP) Reference Standard human pricing
D2850000 Dipyridamole European Pharmacopoeia (EP) Reference Standard human pricing
1220506 Dipyridamole United States Pharmacopeia (USP) Reference Standard human pricing
BP131 Dipyridamole British Pharmacopoeia (BP) Reference Standard human pricing
Y0000802 Dipyridamole for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
BP1102 Dipyridamole impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
1231502 Dyphylline United States Pharmacopeia (USP) Reference Standard human pricing
F8304 Flavoxate hydrochloride ≥98% (HPLC), solid human pricing
Y0000736 Flavoxate hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP571 Flavoxate hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1270708 Flavoxate hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
I0157 Ibudilast ≥99% (HPLC), solid human pricing
SML1099 Roflumilast ≥98% (HPLC) human pricing
PHR1023 Theophylline Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1653004 Theophylline certified reference material, United States Pharmacopeia (USP) Reference Standard human pricing
T0800000 Theophylline European Pharmacopoeia (EP) Reference Standard human pricing
PHL82668 Theophylline phyproof® Reference Substance human pricing
88308 Theophylline ≥99.0% (HPLC) human pricing
BP327 Theophylline British Pharmacopoeia (BP) Reference Standard human pricing
PHR1151 Theophylline melting point standard Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1653117 Theophylline melting point standard United States Pharmacopeia (USP) Reference Standard human pricing
IMPC-051-01 Theophylline solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
D9766 Dipyridamole ≥98% (HPLC) human, mouse pricing
R6520 Rolipram solid, ≥98% (HPLC) human, mouse, rat pricing
T1633 Theophylline anhydrous, ≥99%, powder human, mouse, rat pricing
Z3003 Zardaverine phosphodiesterase inhibitor human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000923 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000923 Rosetta Predictions human pricing
NM_001098818 Rosetta Predictions human pricing
NM_001098819 Rosetta Predictions human pricing
XM_001070301 Rosetta Predictions rat pricing
XM_214325 Rosetta Predictions rat pricing
NM_201607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184993 predicted 1377
2 SASI_Hs02_00303504 predicted 1567
3 SASI_Hs01_00184995 predicted 2495
4 SASI_Hs01_00184996 predicted 677
5 SASI_Hs01_00184997 predicted 2484
6 SASI_Hs01_00184998 predicted 2636
7 SASI_Hs01_00184999 predicted 1643
8 SASI_Hs02_00303505 predicted 2492
9 SASI_Hs01_00185001 predicted 1832
10 SASI_Hs02_00303506 predicted 2481
11 SASI_Hs01_00184992 predicted 1421
12 SASI_Hs01_00184994 predicted 1442
13 SASI_Hs01_00185000 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320034 predicted 1067
2 SASI_Hs02_00320035 predicted 1254
3 SASI_Hs02_00320036 predicted 2177
4 SASI_Hs02_00320037 predicted 370
5 SASI_Hs02_00320038 predicted 2170
6 SASI_Hs02_00320039 predicted 2318
7 SASI_Hs02_00320040 predicted 1338
8 SASI_Hs02_00320041 predicted 2181
9 SASI_Hs02_00320042 predicted 1523
10 SASI_Hs02_00320043 predicted 2173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320044 predicted 1159
2 SASI_Hs02_00320045 predicted 1340
3 SASI_Hs02_00320046 predicted 2275
4 SASI_Hs02_00320047 predicted 452
5 SASI_Hs02_00320048 predicted 2266
6 SASI_Hs02_00320049 predicted 2408
7 SASI_Hs02_00320050 predicted 1428
8 SASI_Hs02_00320051 predicted 2271
9 SASI_Hs02_00320052 predicted 1612
10 SASI_Hs02_00320053 predicted 2265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331158 predicted 970
2 SASI_Rn02_00331159 predicted 1865
3 SASI_Rn02_00331160 predicted 755
4 SASI_Rn02_00331161 predicted 353
5 SASI_Rn02_00331162 predicted 1706
6 SASI_Rn02_00331163 predicted 1766
7 SASI_Rn02_00331164 predicted 1279
8 SASI_Rn02_00331165 predicted 1906
9 SASI_Rn02_00331166 predicted 1056
10 SASI_Rn02_00331167 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375219 predicted 1440
2 SASI_Rn02_00375220 predicted 1319
3 SASI_Rn02_00375221 predicted 1274
4 SASI_Rn02_00375222 predicted 1240
5 SASI_Rn02_00375223 predicted 1258
6 SASI_Rn02_00375224 predicted 1248
7 SASI_Rn02_00375225 predicted 1273
8 SASI_Rn02_00375226 predicted 1305
9 SASI_Rn02_00375227 predicted 1336
10 SASI_Rn02_00375228 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351614 predicted 1961
2 SASI_Mm02_00351615 predicted 945
3 SASI_Mm02_00351616 predicted 2167
4 SASI_Mm02_00351617 predicted 1150
5 SASI_Mm02_00351618 predicted 1419
6 SASI_Mm02_00351619 predicted 893
7 SASI_Mm02_00351620 predicted 869
8 SASI_Mm02_00351621 predicted 2219
9 SASI_Mm02_00351622 predicted 255
10 SASI_Mm02_00351623 predicted 2063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000923
PDE4C MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4C, cAMP-specific
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2611s21c1
Sequence:CCGGTACGATGCCCTGGTGTCTTTCCTCGAGGAAAGACACCAGGGCATCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2709s21c1
Sequence:CCGGAGTCACATCTGTCACTTAATTCTCGAGAATTAAGTGACAGATGTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2499s21c1
Sequence:CCGGGACAATCAAGCTCTTAGTTATCTCGAGATAACTAAGAGCTTGATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-2068s1c1
Sequence:CCGGCCTGACAGATTCCAGTTTGAACTCGAGTTCAAACTGGAATCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-1414s1c1
Sequence:CCGGGTCTCCAACCAGTTTCTGATTCTCGAGAATCAGAAACTGGTTGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-1694s1c1
Sequence:CCGGTGGACAACTATTCCGACCGAACTCGAGTTCGGTCGGAATAGTTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-556s1c1
Sequence:CCGGGACATGATTGTGACGCCCTTTCTCGAGAAAGGGCGTCACAATCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000923
PDE4C MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4C, cAMP-specific
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2611s21c1
Sequence:CCGGTACGATGCCCTGGTGTCTTTCCTCGAGGAAAGACACCAGGGCATCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2709s21c1
Sequence:CCGGAGTCACATCTGTCACTTAATTCTCGAGAATTAAGTGACAGATGTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2499s21c1
Sequence:CCGGGACAATCAAGCTCTTAGTTATCTCGAGATAACTAAGAGCTTGATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-2068s1c1
Sequence:CCGGCCTGACAGATTCCAGTTTGAACTCGAGTTCAAACTGGAATCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-1414s1c1
Sequence:CCGGGTCTCCAACCAGTTTCTGATTCTCGAGAATCAGAAACTGGTTGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-1694s1c1
Sequence:CCGGTGGACAACTATTCCGACCGAACTCGAGTTCGGTCGGAATAGTTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-556s1c1
Sequence:CCGGGACATGATTGTGACGCCCTTTCTCGAGAAAGGGCGTCACAATCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000923
PDE4C MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4C, cAMP-specific
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2611s21c1
Sequence:CCGGTACGATGCCCTGGTGTCTTTCCTCGAGGAAAGACACCAGGGCATCGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2709s21c1
Sequence:CCGGAGTCACATCTGTCACTTAATTCTCGAGAATTAAGTGACAGATGTGACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000923.3-2499s21c1
Sequence:CCGGGACAATCAAGCTCTTAGTTATCTCGAGATAACTAAGAGCTTGATTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-2068s1c1
Sequence:CCGGCCTGACAGATTCCAGTTTGAACTCGAGTTCAAACTGGAATCTGTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-1414s1c1
Sequence:CCGGGTCTCCAACCAGTTTCTGATTCTCGAGAATCAGAAACTGGTTGGAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-1694s1c1
Sequence:CCGGTGGACAACTATTCCGACCGAACTCGAGTTCGGTCGGAATAGTTGTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000923.1-556s1c1
Sequence:CCGGGACATGATTGTGACGCCCTTTCTCGAGAAAGGGCGTCACAATCATGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201607
PDE4C MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4C, cAMP-specific
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-901s1c1
Sequence:CCGGGAGTTGTCTTACCTGTCGGAACTCGAGTTCCGACAGGTAAGACAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1959s1c1
Sequence:CCGGAGAGTGGTATCAGAGTAGGATCTCGAGATCCTACTCTGATACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1438s1c1
Sequence:CCGGGCATGTGCTATACACGACGTACTCGAGTACGTCGTGTATAGCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1135s1c1
Sequence:CCGGGAACTTGAAGACACCAACAAACTCGAGTTTGTTGGTGTCTTCAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-358s1c1
Sequence:CCGGGTCTTCACGATTGGAACTCAACTCGAGTTGAGTTCCAATCGTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201607
PDE4C MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4C, cAMP-specific
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-901s1c1
Sequence:CCGGGAGTTGTCTTACCTGTCGGAACTCGAGTTCCGACAGGTAAGACAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1959s1c1
Sequence:CCGGAGAGTGGTATCAGAGTAGGATCTCGAGATCCTACTCTGATACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1438s1c1
Sequence:CCGGGCATGTGCTATACACGACGTACTCGAGTACGTCGTGTATAGCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1135s1c1
Sequence:CCGGGAACTTGAAGACACCAACAAACTCGAGTTTGTTGGTGTCTTCAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-358s1c1
Sequence:CCGGGTCTTCACGATTGGAACTCAACTCGAGTTGAGTTCCAATCGTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201607
PDE4C MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4C, cAMP-specific
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-901s1c1
Sequence:CCGGGAGTTGTCTTACCTGTCGGAACTCGAGTTCCGACAGGTAAGACAACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1959s1c1
Sequence:CCGGAGAGTGGTATCAGAGTAGGATCTCGAGATCCTACTCTGATACCACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1438s1c1
Sequence:CCGGGCATGTGCTATACACGACGTACTCGAGTACGTCGTGTATAGCACATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-1135s1c1
Sequence:CCGGGAACTTGAAGACACCAACAAACTCGAGTTTGTTGGTGTCTTCAAGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201607.1-358s1c1
Sequence:CCGGGTCTTCACGATTGGAACTCAACTCGAGTTGAGTTCCAATCGTGAAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???