EMAIL THIS PAGE TO A FRIEND

PDE4D

phosphodiesterase 4D, cAMP-specific

254 Gene Product Result for
Synonyms: ACRDYS2 DPDE3 HSPDE4D PDE43 PDE4DN2 STRK1
Gene ID:
Human(5144) Summary: This gene encodes one of four mammalian counterparts to the fruit fly 'dunce' gene. The encoded protein has 3',5'-cyclic-AMP phosphodiesterase activity and degrades cAMP, which acts as a signal transduction molecule in multiple cell types. This gene uses different promoters to generate multiple alternatively spliced transcript variants that encode functional proteins.[provided by RefSeq, Sep 2009]
Mouse(238871) phosphodiesterase 4D, cAMP specific
Rat(24627) phosphodiesterase 4D, cAMP-specific
Zebrafish(566998) phosphodiesterase 4D, cAMP-specific
Horse(100051344) phosphodiesterase 4D, cAMP-specific
chicken(769469) phosphodiesterase 4D, cAMP-specific
domestic cat(101092826) phosphodiesterase 4D, cAMP-specific
dog(487221) phosphodiesterase 4D, cAMP-specific
naked mole-rat(101705115) phosphodiesterase 4D, cAMP-specific
Domestic Rabbit(100351753) phosphodiesterase 4D, cAMP-specific
domestic guinea pig(100302668) phosphodiesterase 4D, cAMP specific
cow(539556) phosphodiesterase 4D, cAMP-specific
sheep(101108953) phosphodiesterase 4D, cAMP-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079491 MISSION® esiRNA esiRNA human PDE4D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104631 Rosetta Predictions human pricing
NM_006203 Rosetta Predictions human pricing
NM_001113328 Rosetta Predictions rat pricing
NM_001113329 Rosetta Predictions rat pricing
NM_001113332 Rosetta Predictions rat pricing
NM_001113334 Rosetta Predictions rat pricing
NM_017032 Rosetta Predictions rat pricing
NM_011056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323824 predicted 1698
2 SASI_Hs02_00323825 predicted 1426
3 SASI_Hs02_00323826 predicted 1725
4 SASI_Hs02_00323827 predicted 1534
5 SASI_Hs02_00323828 predicted 2076
6 SASI_Hs02_00323829 predicted 1581
7 SASI_Hs02_00323830 predicted 1867
8 SASI_Hs02_00323831 predicted 1175
9 SASI_Hs02_00323832 predicted 1771
10 SASI_Hs02_00323833 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225065 predicted 1236
2 SASI_Hs02_00341099 predicted 970
3 SASI_Hs01_00225066 predicted 1263
4 SASI_Hs01_00225067 predicted 1077
5 SASI_Hs01_00225068 predicted 1617
6 SASI_Hs01_00225069 predicted 1119
7 SASI_Hs02_00341100 predicted 1403
8 SASI_Hs02_00341101 predicted 722
9 SASI_Hs01_00225072 predicted 1308
10 SASI_Hs01_00225073 predicted 792
11 SASI_Hs01_00225070 predicted 270
12 SASI_Hs01_00225071 predicted 1140
13 SASI_Hs01_00225074 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251683 predicted 1496
2 SASI_Rn02_00251684 predicted 1241
3 SASI_Rn02_00251685 predicted 2078
4 SASI_Rn02_00251686 predicted 1889
5 SASI_Rn02_00251687 predicted 1697
6 SASI_Rn02_00251688 predicted 896
7 SASI_Rn02_00251689 predicted 1014
8 SASI_Rn02_00251690 predicted 1565
9 SASI_Rn02_00251691 predicted 1082
10 SASI_Rn02_00251692 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251693 predicted 1403
2 SASI_Rn02_00251694 predicted 1152
3 SASI_Rn02_00251695 predicted 1989
4 SASI_Rn02_00251696 predicted 1803
5 SASI_Rn02_00251697 predicted 1620
6 SASI_Rn02_00251698 predicted 805
7 SASI_Rn02_00251699 predicted 925
8 SASI_Rn02_00251700 predicted 1486
9 SASI_Rn02_00251701 predicted 994
10 SASI_Rn02_00251702 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251703 predicted 1342
2 SASI_Rn02_00251704 predicted 1092
3 SASI_Rn02_00251705 predicted 1924
4 SASI_Rn02_00251706 predicted 1745
5 SASI_Rn02_00251707 predicted 1558
6 SASI_Rn02_00251708 predicted 746
7 SASI_Rn02_00251709 predicted 859
8 SASI_Rn02_00251710 predicted 1422
9 SASI_Rn02_00251711 predicted 929
10 SASI_Rn02_00251712 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251713 predicted 1183
2 SASI_Rn02_00251714 predicted 934
3 SASI_Rn02_00251715 predicted 1766
4 SASI_Rn02_00251716 predicted 1580
5 SASI_Rn02_00251717 predicted 1390
6 SASI_Rn02_00251718 predicted 585
7 SASI_Rn02_00251719 predicted 702
8 SASI_Rn02_00251720 predicted 1255
9 SASI_Rn02_00251721 predicted 764
10 SASI_Rn02_00251722 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113070 predicted 1095
2 SASI_Rn02_00261209 predicted 848
3 SASI_Rn01_00113071 predicted 1683
4 SASI_Rn01_00113072 predicted 1496
5 SASI_Rn02_00261210 predicted 1304
6 SASI_Rn01_00113074 predicted 499
7 SASI_Rn02_00261211 predicted 618
8 SASI_Rn02_00261212 predicted 1170
9 SASI_Rn01_00113075 predicted 687
10 SASI_Rn01_00113076 predicted 1141
11 SASI_Rn01_00113068 predicted 915
12 SASI_Rn01_00113069 predicted 1068
13 SASI_Rn01_00113073 predicted 218
14 SASI_Rn01_00113077 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083586 predicted 1461
2 SASI_Mm01_00083587 predicted 702
3 SASI_Mm01_00083588 predicted 2092
4 SASI_Mm01_00083589 predicted 597
5 SASI_Mm01_00083590 predicted 1521
6 SASI_Mm01_00083591 predicted 1901
7 SASI_Mm01_00083592 predicted 624
8 SASI_Mm02_00319812 predicted 2010
9 SASI_Mm01_00083594 predicted 517
10 SASI_Mm01_00083595 predicted 367
11 SASI_Mm01_00083593 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006203
PDE4D MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4D, cAMP-specific
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-303s1c1
Sequence:CCGGGCCAGTGATATACACGGAGATCTCGAGATCTCCGTGTATATCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-188s1c1
Sequence:CCGGCGGGCTAATTCTCCAAGCAAACTCGAGTTTGCTTGGAGAATTAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-451s1c1
Sequence:CCGGCCATCAACAAAGCCACCATAACTCGAGTTATGGTGGCTTTGTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-2062s1c1
Sequence:CCGGCCTGTGTCATAGATGATCGTTCTCGAGAACGATCATCTATGACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-1094s1c1
Sequence:CCGGGCTATTATCTACACCTGCTTTCTCGAGAAAGCAGGTGTAGATAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006203.4-4020s21c1
Sequence:CCGGCCTAGTGTTTACCTGATTATACTCGAGTATAATCAGGTAAACACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-831s21c1
Sequence:CCGGCAGCTCTAGTCTGACTAATTCCTCGAGGAATTAGTCAGACTAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-292s21c1
Sequence:CCGGTATCGATCCGACAGCGATTATCTCGAGATAATCGCTGTCGGATCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-1729s21c1
Sequence:CCGGGTGGGCTTCATAGACTATATTCTCGAGAATATAGTCTATGAAGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-1815s21c1
Sequence:CCGGTTTGGAGGACAATCGTGAATGCTCGAGCATTCACGATTGTCCTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006203
PDE4D MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4D, cAMP-specific
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-303s1c1
Sequence:CCGGGCCAGTGATATACACGGAGATCTCGAGATCTCCGTGTATATCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-188s1c1
Sequence:CCGGCGGGCTAATTCTCCAAGCAAACTCGAGTTTGCTTGGAGAATTAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-451s1c1
Sequence:CCGGCCATCAACAAAGCCACCATAACTCGAGTTATGGTGGCTTTGTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-2062s1c1
Sequence:CCGGCCTGTGTCATAGATGATCGTTCTCGAGAACGATCATCTATGACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-1094s1c1
Sequence:CCGGGCTATTATCTACACCTGCTTTCTCGAGAAAGCAGGTGTAGATAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006203.4-4020s21c1
Sequence:CCGGCCTAGTGTTTACCTGATTATACTCGAGTATAATCAGGTAAACACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-831s21c1
Sequence:CCGGCAGCTCTAGTCTGACTAATTCCTCGAGGAATTAGTCAGACTAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-292s21c1
Sequence:CCGGTATCGATCCGACAGCGATTATCTCGAGATAATCGCTGTCGGATCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-1729s21c1
Sequence:CCGGGTGGGCTTCATAGACTATATTCTCGAGAATATAGTCTATGAAGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-1815s21c1
Sequence:CCGGTTTGGAGGACAATCGTGAATGCTCGAGCATTCACGATTGTCCTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006203
PDE4D MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4D, cAMP-specific
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-303s1c1
Sequence:CCGGGCCAGTGATATACACGGAGATCTCGAGATCTCCGTGTATATCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-188s1c1
Sequence:CCGGCGGGCTAATTCTCCAAGCAAACTCGAGTTTGCTTGGAGAATTAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-451s1c1
Sequence:CCGGCCATCAACAAAGCCACCATAACTCGAGTTATGGTGGCTTTGTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-2062s1c1
Sequence:CCGGCCTGTGTCATAGATGATCGTTCTCGAGAACGATCATCTATGACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006203.3-1094s1c1
Sequence:CCGGGCTATTATCTACACCTGCTTTCTCGAGAAAGCAGGTGTAGATAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006203.4-4020s21c1
Sequence:CCGGCCTAGTGTTTACCTGATTATACTCGAGTATAATCAGGTAAACACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-831s21c1
Sequence:CCGGCAGCTCTAGTCTGACTAATTCCTCGAGGAATTAGTCAGACTAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-292s21c1
Sequence:CCGGTATCGATCCGACAGCGATTATCTCGAGATAATCGCTGTCGGATCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-1729s21c1
Sequence:CCGGGTGGGCTTCATAGACTATATTCTCGAGAATATAGTCTATGAAGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006203.4-1815s21c1
Sequence:CCGGTTTGGAGGACAATCGTGAATGCTCGAGCATTCACGATTGTCCTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011056
PDE4D MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 4D, cAMP-specific
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1668s1c1
Sequence:CCGGGCAAAGACAATCTTTAAGGAACTCGAGTTCCTTAAAGATTGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1118s1c1
Sequence:CCGGCCAGCCTAACTAATTCATGTACTCGAGTACATGAATTAGTTAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1115s1c1
Sequence:CCGGGCTCCAGCCTAACTAATTCATCTCGAGATGAATTAGTTAGGCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-363s1c1
Sequence:CCGGGCGAAGCGAATCAGAGAACATCTCGAGATGTTCTCTGATTCGCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-706s1c1
Sequence:CCGGCGGAACAACTTTGCTGCGTTACTCGAGTAACGCAGCAAAGTTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011056
PDE4D MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 4D, cAMP-specific
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1668s1c1
Sequence:CCGGGCAAAGACAATCTTTAAGGAACTCGAGTTCCTTAAAGATTGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1118s1c1
Sequence:CCGGCCAGCCTAACTAATTCATGTACTCGAGTACATGAATTAGTTAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1115s1c1
Sequence:CCGGGCTCCAGCCTAACTAATTCATCTCGAGATGAATTAGTTAGGCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-363s1c1
Sequence:CCGGGCGAAGCGAATCAGAGAACATCTCGAGATGTTCTCTGATTCGCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-706s1c1
Sequence:CCGGCGGAACAACTTTGCTGCGTTACTCGAGTAACGCAGCAAAGTTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011056
PDE4D MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 4D, cAMP-specific
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1668s1c1
Sequence:CCGGGCAAAGACAATCTTTAAGGAACTCGAGTTCCTTAAAGATTGTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1118s1c1
Sequence:CCGGCCAGCCTAACTAATTCATGTACTCGAGTACATGAATTAGTTAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-1115s1c1
Sequence:CCGGGCTCCAGCCTAACTAATTCATCTCGAGATGAATTAGTTAGGCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-363s1c1
Sequence:CCGGGCGAAGCGAATCAGAGAACATCTCGAGATGTTCTCTGATTCGCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011056.1-706s1c1
Sequence:CCGGCGGAACAACTTTGCTGCGTTACTCGAGTAACGCAGCAAAGTTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)