EMAIL THIS PAGE TO A FRIEND

PDE5A

phosphodiesterase 5A, cGMP-specific

152 Gene Product Result for
Synonyms: CGB-PDE CN5A PDE5
Gene ID:
Human(8654) Summary: This gene encodes a cGMP-binding, cGMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family. This phosphodiesterase specifically hydrolyzes cGMP to 5'-GMP. It is involved in the regulation of intracellular concentrations of cyclic nucleotides and is important for smooth muscle relaxation in the cardiovascular system. Alternative splicing of this gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(242202) phosphodiesterase 5A, cGMP-specific
Rat(171115) phosphodiesterase 5A, cGMP-specific
domestic guinea pig(100527958) phosphodiesterase 5A, cGMP-specific
naked mole-rat(101696421) phosphodiesterase 5A, cGMP-specific
Domestic Rabbit(100354625) phosphodiesterase 5A, cGMP-specific
cow(785098) phosphodiesterase 5A, cGMP-specific
cow(281972) phosphodiesterase 5A, cGMP-specific
sheep(100294560) phosphodiesterase 5A, cGMP-specific
sheep(101109357) phosphodiesterase 5A, cGMP-specific
chicken(422677) phosphodiesterase 5A, cGMP-specific
dog(403825) phosphodiesterase 5A, cGMP-specific
Horse(100072395) phosphodiesterase 5A, cGMP-specific
domestic cat(100533976) phosphodiesterase 5A, cGMP-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023821 MISSION® esiRNA esiRNA targeting mouse Pde5a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083 Rosetta Predictions human pricing
NM_033430 Rosetta Predictions human pricing
NM_033437 Rosetta Predictions human pricing
NM_133584 Rosetta Predictions rat pricing
NM_153422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316842 predicted 1572
2 SASI_Hs01_00039521 predicted 1592
3 SASI_Hs01_00039523 predicted 2111
4 SASI_Hs01_00039524 predicted 1710
5 SASI_Hs01_00039525 predicted 2839
6 SASI_Hs01_00039527 predicted 676
7 SASI_Hs02_00316843 predicted 1221
8 SASI_Hs01_00039528 predicted 683
9 SASI_Hs01_00039529 predicted 905
10 SASI_Hs01_00039530 predicted 804
11 SASI_Hs01_00039522 predicted 1877
12 SASI_Hs01_00039526 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361330 predicted 1411
2 SASI_Hs01_00158116 predicted 1416
3 SASI_Hs01_00158118 predicted 1941
4 SASI_Hs01_00158119 predicted 1547
5 SASI_Hs01_00158120 predicted 2671
6 SASI_Hs01_00158122 predicted 503
7 SASI_Hs02_00361331 predicted 1046
8 SASI_Hs01_00158123 predicted 511
9 SASI_Hs01_00158124 predicted 732
10 SASI_Hs01_00158125 predicted 628
11 SASI_Hs01_00158117 predicted 1699
12 SASI_Hs01_00158121 predicted 1812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361332 predicted 1322
2 SASI_Hs01_00184800 predicted 1332
3 SASI_Hs01_00184802 predicted 1859
4 SASI_Hs01_00184803 predicted 1457
5 SASI_Hs01_00184804 predicted 2586
6 SASI_Hs01_00184806 predicted 413
7 SASI_Hs02_00361333 predicted 967
8 SASI_Hs01_00184807 predicted 433
9 SASI_Hs01_00184808 predicted 651
10 SASI_Hs01_00184809 predicted 542
11 SASI_Hs01_00184801 predicted 1617
12 SASI_Hs01_00184805 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095393 predicted 1906
2 SASI_Rn02_00267783 predicted 1409
3 SASI_Rn01_00095394 predicted 2233
4 SASI_Rn01_00095395 predicted 1331
5 SASI_Rn01_00095396 predicted 895
6 SASI_Rn02_00267784 predicted 1771
7 SASI_Rn02_00267785 predicted 799
8 SASI_Rn01_00095398 predicted 744
9 SASI_Rn01_00095399 predicted 1099
10 SASI_Rn01_00095400 predicted 2661
11 SASI_Rn01_00095397 predicted 654
12 SASI_Rn01_00095401 predicted 2060
13 SASI_Rn01_00095402 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343215 predicted 329
2 SASI_Mm02_00343216 predicted 577
3 SASI_Mm02_00343217 predicted 1733
4 SASI_Mm02_00343218 predicted 663
5 SASI_Mm02_00343219 predicted 1404
6 SASI_Mm02_00343220 predicted 606
7 SASI_Mm02_00343221 predicted 2335
8 SASI_Mm02_00343222 predicted 781
9 SASI_Mm02_00343223 predicted 1593
10 SASI_Mm02_00343224 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083
PDE5A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 5A, cGMP-specific
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-2174s1c1
Sequence:CCGGCCAGCTTTACTGCCATTCAATCTCGAGATTGAATGGCAGTAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-900s1c1
Sequence:CCGGCCTCGGTTCAATGCAGAAGTTCTCGAGAACTTCTGCATTGAACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-2088s1c1
Sequence:CCGGGCATTGCTGATTGCTGCACTACTCGAGTAGTGCAGCAATCAGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-1427s1c1
Sequence:CCGGCCCAGATGTCAGTAAGGATAACTCGAGTTATCCTTACTGACATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-949s1c1
Sequence:CCGGGCATTCTTTGTATGCCAATTACTCGAGTAATTGGCATACAAAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-2549s21c1
Sequence:CCGGCATAGAACCCACTGATCTAATCTCGAGATTAGATCAGTGGGTTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-1597s21c1
Sequence:CCGGTTAAGCCTTTCAACCGAAATGCTCGAGCATTTCGGTTGAAAGGCTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-691s21c1
Sequence:CCGGTGATATCTGCTGACCGCTATTCTCGAGAATAGCGGTCAGCAGATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083
PDE5A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 5A, cGMP-specific
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-2174s1c1
Sequence:CCGGCCAGCTTTACTGCCATTCAATCTCGAGATTGAATGGCAGTAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-900s1c1
Sequence:CCGGCCTCGGTTCAATGCAGAAGTTCTCGAGAACTTCTGCATTGAACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-2088s1c1
Sequence:CCGGGCATTGCTGATTGCTGCACTACTCGAGTAGTGCAGCAATCAGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-1427s1c1
Sequence:CCGGCCCAGATGTCAGTAAGGATAACTCGAGTTATCCTTACTGACATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-949s1c1
Sequence:CCGGGCATTCTTTGTATGCCAATTACTCGAGTAATTGGCATACAAAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-2549s21c1
Sequence:CCGGCATAGAACCCACTGATCTAATCTCGAGATTAGATCAGTGGGTTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-1597s21c1
Sequence:CCGGTTAAGCCTTTCAACCGAAATGCTCGAGCATTTCGGTTGAAAGGCTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-691s21c1
Sequence:CCGGTGATATCTGCTGACCGCTATTCTCGAGAATAGCGGTCAGCAGATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083
PDE5A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 5A, cGMP-specific
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-2174s1c1
Sequence:CCGGCCAGCTTTACTGCCATTCAATCTCGAGATTGAATGGCAGTAAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-900s1c1
Sequence:CCGGCCTCGGTTCAATGCAGAAGTTCTCGAGAACTTCTGCATTGAACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-2088s1c1
Sequence:CCGGGCATTGCTGATTGCTGCACTACTCGAGTAGTGCAGCAATCAGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-1427s1c1
Sequence:CCGGCCCAGATGTCAGTAAGGATAACTCGAGTTATCCTTACTGACATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001083.2-949s1c1
Sequence:CCGGGCATTCTTTGTATGCCAATTACTCGAGTAATTGGCATACAAAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-2549s21c1
Sequence:CCGGCATAGAACCCACTGATCTAATCTCGAGATTAGATCAGTGGGTTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-1597s21c1
Sequence:CCGGTTAAGCCTTTCAACCGAAATGCTCGAGCATTTCGGTTGAAAGGCTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083.3-691s21c1
Sequence:CCGGTGATATCTGCTGACCGCTATTCTCGAGAATAGCGGTCAGCAGATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153422
PDE5A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 5A, cGMP-specific
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-140s1c1
Sequence:CCGGCCGGGACTTTACCTTCTCTTACTCGAGTAAGAGAAGGTAAAGTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-2138s1c1
Sequence:CCGGCCTCTCCATTGACGAATATAACTCGAGTTATATTCGTCAATGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153422.1-2814s1c1
Sequence:CCGGGCTACCTACTTTCCATCCTTTCTCGAGAAAGGATGGAAAGTAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-1962s1c1
Sequence:CCGGGCGTTGCTCATTGCTGCTTTACTCGAGTAAAGCAGCAATGAGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-2137s1c1
Sequence:CCGGGCCTCTCCATTGACGAATATACTCGAGTATATTCGTCAATGGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153422
PDE5A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 5A, cGMP-specific
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-140s1c1
Sequence:CCGGCCGGGACTTTACCTTCTCTTACTCGAGTAAGAGAAGGTAAAGTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-2138s1c1
Sequence:CCGGCCTCTCCATTGACGAATATAACTCGAGTTATATTCGTCAATGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153422.1-2814s1c1
Sequence:CCGGGCTACCTACTTTCCATCCTTTCTCGAGAAAGGATGGAAAGTAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-1962s1c1
Sequence:CCGGGCGTTGCTCATTGCTGCTTTACTCGAGTAAAGCAGCAATGAGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-2137s1c1
Sequence:CCGGGCCTCTCCATTGACGAATATACTCGAGTATATTCGTCAATGGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153422
PDE5A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 5A, cGMP-specific
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-140s1c1
Sequence:CCGGCCGGGACTTTACCTTCTCTTACTCGAGTAAGAGAAGGTAAAGTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-2138s1c1
Sequence:CCGGCCTCTCCATTGACGAATATAACTCGAGTTATATTCGTCAATGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114991    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153422.1-2814s1c1
Sequence:CCGGGCTACCTACTTTCCATCCTTTCTCGAGAAAGGATGGAAAGTAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-1962s1c1
Sequence:CCGGGCGTTGCTCATTGCTGCTTTACTCGAGTAAAGCAGCAATGAGCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153422.1-2137s1c1
Sequence:CCGGGCCTCTCCATTGACGAATATACTCGAGTATATTCGTCAATGGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)