EMAIL THIS PAGE TO A FRIEND

PDE6A

phosphodiesterase 6A, cGMP-specific, rod, alpha

61 Gene Product Result for
Synonyms: CGPR-A PDEA RP43
UniProtKB ID: P16499, Q0P638
Gene ID:
Human(5145) Summary: This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
Mouse(225600) phosphodiesterase 6A, cGMP-specific, rod, alpha
Rat(307401) phosphodiesterase 6A, cGMP-specific, rod, alpha
Zebrafish(368410) phosphodiesterase 6A, cGMP-specific, rod, alpha
domestic cat(101085100) phosphodiesterase 6A, cGMP-specific, rod, alpha
dog(403620) phosphodiesterase 6A, cGMP-specific, rod, alpha
cow(281973) phosphodiesterase 6A, cGMP-specific, rod, alpha
sheep(101122024) phosphodiesterase 6A, cGMP-specific, rod, alpha
Domestic Rabbit(100342363) phosphodiesterase 6A, cGMP-specific, rod, alpha
naked mole-rat(101718823) phosphodiesterase 6A, cGMP-specific, rod, alpha
domestic guinea pig(100725241) phosphodiesterase 6A, cGMP-specific, rod, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0759 AQUA Peptide FHIPQEALV[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000440 Rosetta Predictions human pricing
NM_001107386 Rosetta Predictions rat pricing
NM_146086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158674 predicted 1652
2 SASI_Hs01_00158675 predicted 2415
3 SASI_Hs01_00158676 predicted 2175
4 SASI_Hs01_00158677 predicted 1305
5 SASI_Hs01_00158678 predicted 1579
6 SASI_Hs01_00158680 predicted 2096
7 SASI_Hs01_00158681 predicted 795
8 SASI_Hs01_00158683 predicted 1129
9 SASI_Hs02_00302556 predicted 1697
10 SASI_Hs02_00302557 predicted 1099
11 SASI_Hs01_00158679 predicted 678
12 SASI_Hs01_00158682 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228305 predicted 892
2 SASI_Rn02_00228306 predicted 1481
3 SASI_Rn02_00228307 predicted 2157
4 SASI_Rn02_00228308 predicted 722
5 SASI_Rn02_00228309 predicted 244
6 SASI_Rn02_00228310 predicted 927
7 SASI_Rn02_00228311 predicted 1211
8 SASI_Rn02_00228312 predicted 2490
9 SASI_Rn02_00228313 predicted 839
10 SASI_Rn02_00228314 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157394 predicted 244
2 SASI_Mm01_00157395 predicted 659
3 SASI_Mm01_00157396 predicted 2158
4 SASI_Mm01_00157397 predicted 325
5 SASI_Mm01_00157400 predicted 1165
6 SASI_Mm01_00157401 predicted 277
7 SASI_Mm01_00157402 predicted 592
8 SASI_Mm01_00157403 predicted 1991
9 SASI_Mm02_00341721 predicted 931
10 SASI_Mm02_00341722 predicted 1420
11 SASI_Mm01_00157398 predicted 674
12 SASI_Mm01_00157399 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000440
PDE6A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6A, cGMP-specific, rod, alpha
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000440.2-150s21c1
Sequence:CCGGGAAGTTCCTGGACTCGAATATCTCGAGATATTCGAGTCCAGGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000440.2-2235s21c1
Sequence:CCGGGACACGGAAGGAAATCGTTATCTCGAGATAACGATTTCCTTCCGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-2172s1c1
Sequence:CCGGCGTGGATCAGTCTAAGACATACTCGAGTATGTCTTAGACTGATCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-688s1c1
Sequence:CCGGGCCATAATCATGGCTGTGAATCTCGAGATTCACAGCCATGATTATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-2092s1c1
Sequence:CCGGGCCATCCACATGATGGACATTCTCGAGAATGTCCATCATGTGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-1285s1c1
Sequence:CCGGCCGATTGTGAACAAGAAGGAACTCGAGTTCCTTCTTGTTCACAATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000440.1-2783s1c1
Sequence:CCGGCTTGAGAAGTAGAAGAGTCATCTCGAGATGACTCTTCTACTTCTCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000440
PDE6A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6A, cGMP-specific, rod, alpha
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000440.2-150s21c1
Sequence:CCGGGAAGTTCCTGGACTCGAATATCTCGAGATATTCGAGTCCAGGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000440.2-2235s21c1
Sequence:CCGGGACACGGAAGGAAATCGTTATCTCGAGATAACGATTTCCTTCCGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-2172s1c1
Sequence:CCGGCGTGGATCAGTCTAAGACATACTCGAGTATGTCTTAGACTGATCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-688s1c1
Sequence:CCGGGCCATAATCATGGCTGTGAATCTCGAGATTCACAGCCATGATTATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-2092s1c1
Sequence:CCGGGCCATCCACATGATGGACATTCTCGAGAATGTCCATCATGTGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-1285s1c1
Sequence:CCGGCCGATTGTGAACAAGAAGGAACTCGAGTTCCTTCTTGTTCACAATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000440.1-2783s1c1
Sequence:CCGGCTTGAGAAGTAGAAGAGTCATCTCGAGATGACTCTTCTACTTCTCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000440
PDE6A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6A, cGMP-specific, rod, alpha
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000440.2-150s21c1
Sequence:CCGGGAAGTTCCTGGACTCGAATATCTCGAGATATTCGAGTCCAGGAACTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000440.2-2235s21c1
Sequence:CCGGGACACGGAAGGAAATCGTTATCTCGAGATAACGATTTCCTTCCGTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-2172s1c1
Sequence:CCGGCGTGGATCAGTCTAAGACATACTCGAGTATGTCTTAGACTGATCCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-688s1c1
Sequence:CCGGGCCATAATCATGGCTGTGAATCTCGAGATTCACAGCCATGATTATGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-2092s1c1
Sequence:CCGGGCCATCCACATGATGGACATTCTCGAGAATGTCCATCATGTGGATGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000440.1-1285s1c1
Sequence:CCGGCCGATTGTGAACAAGAAGGAACTCGAGTTCCTTCTTGTTCACAATCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000440.1-2783s1c1
Sequence:CCGGCTTGAGAAGTAGAAGAGTCATCTCGAGATGACTCTTCTACTTCTCAAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146086
PDE6A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6A, cGMP-specific, rod, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146086.2-2792s1c1
Sequence:CCGGGCAGGCATCTATATCATCAAACTCGAGTTTGATGATATAGATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-1765s1c1
Sequence:CCGGCCGGAGAATCACTTACCACAACTCGAGTTGTGGTAAGTGATTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-326s1c1
Sequence:CCGGGCTGAGAAATGCACATTCAATCTCGAGATTGAATGTGCATTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-1994s1c1
Sequence:CCGGCATCATTTGGAGTTTGGCAAACTCGAGTTTGCCAAACTCCAAATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-2472s1c1
Sequence:CCGGCCCGATTTCATGAGGAGATTACTCGAGTAATCTCCTCATGAAATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146086
PDE6A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6A, cGMP-specific, rod, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146086.2-2792s1c1
Sequence:CCGGGCAGGCATCTATATCATCAAACTCGAGTTTGATGATATAGATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-1765s1c1
Sequence:CCGGCCGGAGAATCACTTACCACAACTCGAGTTGTGGTAAGTGATTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-326s1c1
Sequence:CCGGGCTGAGAAATGCACATTCAATCTCGAGATTGAATGTGCATTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-1994s1c1
Sequence:CCGGCATCATTTGGAGTTTGGCAAACTCGAGTTTGCCAAACTCCAAATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-2472s1c1
Sequence:CCGGCCCGATTTCATGAGGAGATTACTCGAGTAATCTCCTCATGAAATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146086
PDE6A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6A, cGMP-specific, rod, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114941    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146086.2-2792s1c1
Sequence:CCGGGCAGGCATCTATATCATCAAACTCGAGTTTGATGATATAGATGCCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-1765s1c1
Sequence:CCGGCCGGAGAATCACTTACCACAACTCGAGTTGTGGTAAGTGATTCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-326s1c1
Sequence:CCGGGCTGAGAAATGCACATTCAATCTCGAGATTGAATGTGCATTTCTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-1994s1c1
Sequence:CCGGCATCATTTGGAGTTTGGCAAACTCGAGTTTGCCAAACTCCAAATGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000114944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146086.2-2472s1c1
Sequence:CCGGCCCGATTTCATGAGGAGATTACTCGAGTAATCTCCTCATGAAATCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???