EMAIL THIS PAGE TO A FRIEND

PDE6B

phosphodiesterase 6B, cGMP-specific, rod, beta

57 Gene Product Result for
Synonyms: CSNB3 CSNBAD2 PDEB RP40 rd1
UniProtKB ID: P35913, B7Z9T9, E7ETT3, Q53XN5, Q9BWH5, Q9UD49
Gene ID:
Human(5158) Summary: Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(18587) phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Rat(289878) phosphodiesterase 6B, cGMP-specific, rod, beta
domestic guinea pig(100721588) phosphodiesterase 6B, cGMP-specific, rod, beta
naked mole-rat(101705017) phosphodiesterase 6B, cGMP-specific, rod, beta
cow(281974) phosphodiesterase 6B, cGMP-specific, rod, beta
sheep(101108490) phosphodiesterase 6B, cGMP-specific, rod, beta
Zebrafish(559332) phosphodiesterase 6B, cGMP-specific, rod, beta
domestic cat(101095012) phosphodiesterase 6B, cGMP-specific, rod, beta
dog(399653) phosphodiesterase 6B, cGMP-specific, rod, beta
chicken(395092) phosphodiesterase 6B, cGMP-specific, rod, beta (congenital stationary night blindness 3, autosomal dominant)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000283 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000283 Rosetta Predictions human pricing
NM_001106024 Rosetta Predictions rat pricing
NM_008806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224183 predicted 1083
2 SASI_Hs01_00224184 predicted 1853
3 SASI_Hs01_00224185 predicted 1529
4 SASI_Hs01_00224186 predicted 543
5 SASI_Hs01_00224187 predicted 1213
6 SASI_Hs01_00224188 predicted 691
7 SASI_Hs01_00224189 predicted 965
8 SASI_Hs01_00224190 predicted 1756
9 SASI_Hs02_00302240 predicted 1222
10 SASI_Hs02_00302241 predicted 691
11 SASI_Hs01_00224191 predicted 1071
12 SASI_Hs01_00224192 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214872 predicted 1069
2 SASI_Rn02_00214873 predicted 1872
3 SASI_Rn02_00214874 predicted 1759
4 SASI_Rn02_00214875 predicted 1515
5 SASI_Rn02_00214876 predicted 455
6 SASI_Rn02_00214877 predicted 1924
7 SASI_Rn02_00214878 predicted 678
8 SASI_Rn02_00214879 predicted 1598
9 SASI_Rn02_00214880 predicted 1853
10 SASI_Rn02_00214881 predicted 2167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314722 predicted 264
2 SASI_Mm01_00087345 predicted 1108
3 SASI_Mm01_00087346 predicted 1960
4 SASI_Mm01_00087348 predicted 714
5 SASI_Mm01_00087349 predicted 2374
6 SASI_Mm01_00087350 predicted 2206
7 SASI_Mm01_00087351 predicted 1487
8 SASI_Mm01_00087352 predicted 1628
9 SASI_Mm01_00087353 predicted 1018
10 SASI_Mm02_00314723 predicted 1129
11 SASI_Mm01_00087344 predicted 1856
12 SASI_Mm01_00087347 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008806
PDE6B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6B, cGMP-specific, rod, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008806.1-2573s1c1
Sequence:CCGGCCGTGTTTCATGGCTTTGGGTCTCGAGACCCAAAGCCATGAAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-1884s1c1
Sequence:CCGGCCACCTGGAATTTGGGAAGTTCTCGAGAACTTCCCAAATTCCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-798s1c1
Sequence:CCGGCTATCTAAACTGCGAACGGTACTCGAGTACCGTTCGCAGTTTAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-298s1c1
Sequence:CCGGCGCAATGGCATAGCTGAACTTCTCGAGAAGTTCAGCTATGCCATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008806.2-1709s21c1
Sequence:CCGGAGCAAAGCCTATCGAAGAATCCTCGAGGATTCTTCGATAGGCTTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008806
PDE6B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6B, cGMP-specific, rod, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008806.1-2573s1c1
Sequence:CCGGCCGTGTTTCATGGCTTTGGGTCTCGAGACCCAAAGCCATGAAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-1884s1c1
Sequence:CCGGCCACCTGGAATTTGGGAAGTTCTCGAGAACTTCCCAAATTCCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-798s1c1
Sequence:CCGGCTATCTAAACTGCGAACGGTACTCGAGTACCGTTCGCAGTTTAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-298s1c1
Sequence:CCGGCGCAATGGCATAGCTGAACTTCTCGAGAAGTTCAGCTATGCCATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008806.2-1709s21c1
Sequence:CCGGAGCAAAGCCTATCGAAGAATCCTCGAGGATTCTTCGATAGGCTTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008806
PDE6B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6B, cGMP-specific, rod, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008806.1-2573s1c1
Sequence:CCGGCCGTGTTTCATGGCTTTGGGTCTCGAGACCCAAAGCCATGAAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-1884s1c1
Sequence:CCGGCCACCTGGAATTTGGGAAGTTCTCGAGAACTTCCCAAATTCCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-798s1c1
Sequence:CCGGCTATCTAAACTGCGAACGGTACTCGAGTACCGTTCGCAGTTTAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008806.1-298s1c1
Sequence:CCGGCGCAATGGCATAGCTGAACTTCTCGAGAAGTTCAGCTATGCCATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008806.2-1709s21c1
Sequence:CCGGAGCAAAGCCTATCGAAGAATCCTCGAGGATTCTTCGATAGGCTTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000283
PDE6B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6B, cGMP-specific, rod, beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-1104s1c1
Sequence:CCGGCGCTGACGAAATGTTCAAATTCTCGAGAATTTGAACATTTCGTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-2452s1c1
Sequence:CCGGGCTGATGAGTATGAGGCCAAACTCGAGTTTGGCCTCATACTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-519s1c1
Sequence:CCGGGCTCACTGACTACAAGACAAACTCGAGTTTGTCTTGTAGTCAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-946s1c1
Sequence:CCGGCGGGAAATTGTCTTCTACAAACTCGAGTTTGTAGAAGACAATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-1506s1c1
Sequence:CCGGGCCCACCACATTTGACATCTACTCGAGTAGATGTCAAATGTGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000283.3-1093s21c1
Sequence:CCGGACGTGGCAGAAAGCGGCTTTACTCGAGTAAAGCCGCTTTCTGCCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000283.3-3081s21c1
Sequence:CCGGATAAACTGTAGCCTACATTACCTCGAGGTAATGTAGGCTACAGTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000283.3-703s21c1
Sequence:CCGGCGTTGTACCTGAAGATCTATCCTCGAGGATAGATCTTCAGGTACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000283
PDE6B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6B, cGMP-specific, rod, beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-1104s1c1
Sequence:CCGGCGCTGACGAAATGTTCAAATTCTCGAGAATTTGAACATTTCGTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-2452s1c1
Sequence:CCGGGCTGATGAGTATGAGGCCAAACTCGAGTTTGGCCTCATACTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-519s1c1
Sequence:CCGGGCTCACTGACTACAAGACAAACTCGAGTTTGTCTTGTAGTCAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-946s1c1
Sequence:CCGGCGGGAAATTGTCTTCTACAAACTCGAGTTTGTAGAAGACAATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-1506s1c1
Sequence:CCGGGCCCACCACATTTGACATCTACTCGAGTAGATGTCAAATGTGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000283.3-1093s21c1
Sequence:CCGGACGTGGCAGAAAGCGGCTTTACTCGAGTAAAGCCGCTTTCTGCCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000283.3-3081s21c1
Sequence:CCGGATAAACTGTAGCCTACATTACCTCGAGGTAATGTAGGCTACAGTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000283.3-703s21c1
Sequence:CCGGCGTTGTACCTGAAGATCTATCCTCGAGGATAGATCTTCAGGTACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000283
PDE6B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6B, cGMP-specific, rod, beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-1104s1c1
Sequence:CCGGCGCTGACGAAATGTTCAAATTCTCGAGAATTTGAACATTTCGTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-2452s1c1
Sequence:CCGGGCTGATGAGTATGAGGCCAAACTCGAGTTTGGCCTCATACTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-519s1c1
Sequence:CCGGGCTCACTGACTACAAGACAAACTCGAGTTTGTCTTGTAGTCAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-946s1c1
Sequence:CCGGCGGGAAATTGTCTTCTACAAACTCGAGTTTGTAGAAGACAATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000283.1-1506s1c1
Sequence:CCGGGCCCACCACATTTGACATCTACTCGAGTAGATGTCAAATGTGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000283.3-1093s21c1
Sequence:CCGGACGTGGCAGAAAGCGGCTTTACTCGAGTAAAGCCGCTTTCTGCCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000283.3-3081s21c1
Sequence:CCGGATAAACTGTAGCCTACATTACCTCGAGGTAATGTAGGCTACAGTTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000283.3-703s21c1
Sequence:CCGGCGTTGTACCTGAAGATCTATCCTCGAGGATAGATCTTCAGGTACAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)