EMAIL THIS PAGE TO A FRIEND

PDE6C

phosphodiesterase 6C, cGMP-specific, cone, alpha prime

48 Gene Product Result for
Synonyms: ACHM5 COD4 PDEA2
UniProtKB ID: P51160, A6NCR6, Q5VY29
Gene ID:
Human(5146) Summary: This gene encodes the alpha-prime subunit of cone phosphodiesterase, which is composed of a homodimer of two alpha-prime subunits and 3 smaller proteins of 11, 13, and 15 kDa. Mutations in this gene are associated with cone dystrophy type 4 (COD4). [provided by RefSeq, Mar 2010]
Mouse(110855) phosphodiesterase 6C, cGMP specific, cone, alpha prime
Rat(361752) phosphodiesterase 6C, cGMP specific, cone, alpha prime
Zebrafish(393845) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
dog(486805) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
domestic cat(101094627) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
chicken(395834) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
cow(281975) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
sheep(101104795) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
naked mole-rat(101702814) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
Domestic Rabbit(100343836) phosphodiesterase 6C, cGMP-specific, cone, alpha prime
domestic guinea pig(100527954) phosphodiesterase 6C, cGMP specific, cone, alpha prime
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301616 ANTI-PDE6C (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB4301063 Anti-PDE6C antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006204 Rosetta Predictions human pricing
NM_001108522 Rosetta Predictions rat pricing
NM_033614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153565 predicted 2235
2 SASI_Hs01_00153567 predicted 2265
3 SASI_Hs02_00341102 predicted 641
4 SASI_Hs01_00153568 predicted 2291
5 SASI_Hs02_00341103 predicted 1564
6 SASI_Hs01_00153569 predicted 845
7 SASI_Hs01_00153570 predicted 859
8 SASI_Hs01_00153571 predicted 1260
9 SASI_Hs01_00153572 predicted 825
10 SASI_Hs02_00341104 predicted 1038
11 SASI_Hs01_00153566 predicted 2529
12 SASI_Hs01_00153573 predicted 801
13 SASI_Hs01_00153574 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239479 predicted 1249
2 SASI_Rn02_00239480 predicted 2204
3 SASI_Rn02_00239481 predicted 717
4 SASI_Rn02_00239482 predicted 684
5 SASI_Rn02_00239483 predicted 1640
6 SASI_Rn02_00239484 predicted 1117
7 SASI_Rn02_00239485 predicted 1730
8 SASI_Rn02_00239486 predicted 1816
9 SASI_Rn02_00239487 predicted 1011
10 SASI_Rn02_00239488 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152749 predicted 1253
2 SASI_Mm01_00152750 predicted 721
3 SASI_Mm02_00337471 predicted 683
4 SASI_Mm01_00152751 predicted 644
5 SASI_Mm01_00152752 predicted 935
6 SASI_Mm01_00152753 predicted 1386
7 SASI_Mm01_00152754 predicted 738
8 SASI_Mm01_00152755 predicted 270
9 SASI_Mm01_00152756 predicted 2231
10 SASI_Mm02_00337472 predicted 1709
11 SASI_Mm01_00152757 predicted 1443
12 SASI_Mm01_00152758 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006204
PDE6C MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6C, cGMP-specific, cone, alpha prime
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006204.3-1377s21c1
Sequence:CCGGTTTCGATGAGCATGATGAATACTCGAGTATTCATCATGCTCATCGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006204.3-2126s21c1
Sequence:CCGGATTTGTTCGAGGTCGCAATAACTCGAGTTATTGCGACCTCGAACAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-2104s1c1
Sequence:CCGGCGGCAGTTTGAAACAGTTATTCTCGAGAATAACTGTTTCAAACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-526s1c1
Sequence:CCGGCCTGACAAAGAAGTTGTGTTTCTCGAGAAACACAACTTCTTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-2236s1c1
Sequence:CCGGGCCATCAAATATGTAACTGTTCTCGAGAACAGTTACATATTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-1234s1c1
Sequence:CCGGGCGGATGAATACTTCACATTTCTCGAGAAATGTGAAGTATTCATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-786s1c1
Sequence:CCGGCCTCAACTTTGTGTCTATCATCTCGAGATGATAGACACAAAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006204
PDE6C MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6C, cGMP-specific, cone, alpha prime
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006204.3-1377s21c1
Sequence:CCGGTTTCGATGAGCATGATGAATACTCGAGTATTCATCATGCTCATCGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006204.3-2126s21c1
Sequence:CCGGATTTGTTCGAGGTCGCAATAACTCGAGTTATTGCGACCTCGAACAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-2104s1c1
Sequence:CCGGCGGCAGTTTGAAACAGTTATTCTCGAGAATAACTGTTTCAAACTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-526s1c1
Sequence:CCGGCCTGACAAAGAAGTTGTGTTTCTCGAGAAACACAACTTCTTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-2236s1c1
Sequence:CCGGGCCATCAAATATGTAACTGTTCTCGAGAACAGTTACATATTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-1234s1c1
Sequence:CCGGGCGGATGAATACTTCACATTTCTCGAGAAATGTGAAGTATTCATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-786s1c1
Sequence:CCGGCCTCAACTTTGTGTCTATCATCTCGAGATGATAGACACAAAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006204
PDE6C MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6C, cGMP-specific, cone, alpha prime
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006204.3-1377s21c1
Sequence:CCGGTTTCGATGAGCATGATGAATACTCGAGTATTCATCATGCTCATCGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006204.3-2126s21c1
Sequence:CCGGATTTGTTCGAGGTCGCAATAACTCGAGTTATTGCGACCTCGAACAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-2104s1c1
Sequence:CCGGCGGCAGTTTGAAACAGTTATTCTCGAGAATAACTGTTTCAAACTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-526s1c1
Sequence:CCGGCCTGACAAAGAAGTTGTGTTTCTCGAGAAACACAACTTCTTTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-2236s1c1
Sequence:CCGGGCCATCAAATATGTAACTGTTCTCGAGAACAGTTACATATTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-1234s1c1
Sequence:CCGGGCGGATGAATACTTCACATTTCTCGAGAAATGTGAAGTATTCATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006204.2-786s1c1
Sequence:CCGGCCTCAACTTTGTGTCTATCATCTCGAGATGATAGACACAAAGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033614
VALIDATED
PDE6C MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6C, cGMP-specific, cone, alpha prime
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1134s21c1
Sequence:CCGGTGAGACTGGCTGGGTCATTAACTCGAGTTAATGACCCAGCCAGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033614.1-1389s21c1
Sequence:CCGGCCCGGATGAAATCAGCTCTATCTCGAGATAGAGCTGATTTCATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1823s21c1
Sequence:CCGGGCACCAATAACTTGTACCAAACTCGAGTTTGGTACAAGTTATTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033614.1-2014s21c1
Sequence:CCGGACTGACCTGGCACTCTATTTCCTCGAGGAAATAGAGTGCCAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1427s21c1
Sequence:CCGGAGTTAAATGTAGAGGTAATTGCTCGAGCAATTACCTCTACATTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1389s1c1
Sequence:CCGGCCCGGATGAAATCAGCTCTATCTCGAGATAGAGCTGATTTCATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-409s1c1
Sequence:CCGGCCGTTGGACATTGGGATAGTTCTCGAGAACTATCCCAATGTCCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1823s1c1
Sequence:CCGGGCACCAATAACTTGTACCAAACTCGAGTTTGGTACAAGTTATTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-2318s1c1
Sequence:CCGGCGAAACTTCAAGTGGGATTTACTCGAGTAAATCCCACTTGAAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1390s1c1
Sequence:CCGGCCGGATGAAATCAGCTCTATTCTCGAGAATAGAGCTGATTTCATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033614
VALIDATED
PDE6C MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6C, cGMP-specific, cone, alpha prime
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1134s21c1
Sequence:CCGGTGAGACTGGCTGGGTCATTAACTCGAGTTAATGACCCAGCCAGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033614.1-1389s21c1
Sequence:CCGGCCCGGATGAAATCAGCTCTATCTCGAGATAGAGCTGATTTCATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1823s21c1
Sequence:CCGGGCACCAATAACTTGTACCAAACTCGAGTTTGGTACAAGTTATTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033614.1-2014s21c1
Sequence:CCGGACTGACCTGGCACTCTATTTCCTCGAGGAAATAGAGTGCCAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1427s21c1
Sequence:CCGGAGTTAAATGTAGAGGTAATTGCTCGAGCAATTACCTCTACATTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1389s1c1
Sequence:CCGGCCCGGATGAAATCAGCTCTATCTCGAGATAGAGCTGATTTCATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-409s1c1
Sequence:CCGGCCGTTGGACATTGGGATAGTTCTCGAGAACTATCCCAATGTCCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1823s1c1
Sequence:CCGGGCACCAATAACTTGTACCAAACTCGAGTTTGGTACAAGTTATTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-2318s1c1
Sequence:CCGGCGAAACTTCAAGTGGGATTTACTCGAGTAAATCCCACTTGAAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1390s1c1
Sequence:CCGGCCGGATGAAATCAGCTCTATTCTCGAGAATAGAGCTGATTTCATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033614
VALIDATED
PDE6C MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6C, cGMP-specific, cone, alpha prime
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1134s21c1
Sequence:CCGGTGAGACTGGCTGGGTCATTAACTCGAGTTAATGACCCAGCCAGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033614.1-1389s21c1
Sequence:CCGGCCCGGATGAAATCAGCTCTATCTCGAGATAGAGCTGATTTCATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1823s21c1
Sequence:CCGGGCACCAATAACTTGTACCAAACTCGAGTTTGGTACAAGTTATTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033614.1-2014s21c1
Sequence:CCGGACTGACCTGGCACTCTATTTCCTCGAGGAAATAGAGTGCCAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033614.1-1427s21c1
Sequence:CCGGAGTTAAATGTAGAGGTAATTGCTCGAGCAATTACCTCTACATTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1389s1c1
Sequence:CCGGCCCGGATGAAATCAGCTCTATCTCGAGATAGAGCTGATTTCATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-409s1c1
Sequence:CCGGCCGTTGGACATTGGGATAGTTCTCGAGAACTATCCCAATGTCCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1823s1c1
Sequence:CCGGGCACCAATAACTTGTACCAAACTCGAGTTTGGTACAAGTTATTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-2318s1c1
Sequence:CCGGCGAAACTTCAAGTGGGATTTACTCGAGTAAATCCCACTTGAAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033614.1-1390s1c1
Sequence:CCGGCCGGATGAAATCAGCTCTATTCTCGAGAATAGAGCTGATTTCATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)