EMAIL THIS PAGE TO A FRIEND

PDE6D

phosphodiesterase 6D, cGMP-specific, rod, delta

91 Gene Product Result for
Synonyms: PDED
UniProtKB ID: O43924, O43250
Gene ID:
Mouse(18582) phosphodiesterase 6D, cGMP-specific, rod, delta
Rat(363272) phosphodiesterase 6D, cGMP-specific, rod, delta
domestic guinea pig(100734925) phosphodiesterase 6D, cGMP-specific, rod, delta
naked mole-rat(101702746) phosphodiesterase 6D, cGMP-specific, rod, delta
cow(281976) phosphodiesterase 6D, cGMP-specific, rod, delta
sheep(101108369) phosphodiesterase 6D, cGMP-specific, rod, delta
Zebrafish(436981) phosphodiesterase 6D, cGMP-specific, rod, delta
domestic cat(101096755) phosphodiesterase 6D, cGMP-specific, rod, delta
dog(403781) phosphodiesterase 6D, cGMP-specific, rod, delta
chicken(424932) phosphodiesterase 6D, cGMP-specific, rod, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002601 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132211 MISSION® esiRNA esiRNA human PDE6D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002601 Rosetta Predictions human pricing
NM_001108806 Rosetta Predictions rat pricing
NM_008801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094664 predicted 412
2 SASI_Hs01_00094665 predicted 383
3 SASI_Hs01_00094666 predicted 318
4 SASI_Hs01_00094667 predicted 229
5 SASI_Hs01_00094668 predicted 748
6 SASI_Hs01_00094669 predicted 507
7 SASI_Hs01_00094670 predicted 515
8 SASI_Hs02_00334112 predicted 784
9 SASI_Hs01_00094671 predicted 569
10 SASI_Hs01_00094673 predicted 306
11 SASI_Hs01_00094672 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242255 predicted 303
2 SASI_Rn02_00242256 predicted 525
3 SASI_Rn02_00242257 predicted 495
4 SASI_Rn02_00242258 predicted 521
5 SASI_Rn02_00242259 predicted 217
6 SASI_Rn02_00242260 predicted 787
7 SASI_Rn02_00242261 predicted 591
8 SASI_Rn02_00242262 predicted 812
9 SASI_Rn02_00242263 predicted 201
10 SASI_Rn02_00242264 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063459 predicted 693
2 SASI_Mm01_00063462 predicted 845
3 SASI_Mm01_00063463 predicted 204
4 SASI_Mm01_00063464 predicted 810
5 SASI_Mm01_00063467 predicted 608
6 SASI_Mm02_00314715 predicted 730
7 SASI_Mm02_00314716 predicted 828
8 SASI_Mm02_00314717 predicted 326
9 SASI_Mm02_00314718 predicted 595
10 SASI_Mm01_00063458 predicted 688
11 SASI_Mm01_00063460 predicted 391
12 SASI_Mm01_00063461 predicted 545
13 SASI_Mm01_00063465 predicted 314
14 SASI_Mm01_00063466 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008801
VALIDATED
PDE6D MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6D, cGMP-specific, rod, delta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-924s1c1
Sequence:CCGGGCTTTCTTTAGCCTCTGGTTTCTCGAGAAACCAGAGGCTAAAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-414s1c1
Sequence:CCGGGAAGAGTGGTTCTTCGAGTTTCTCGAGAAACTCGAAGAACCACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008801.2-530s1c1
Sequence:CCGGTGTCATCATAGAGACAAAGTTCTCGAGAACTTTGTCTCTATGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-193s1c1
Sequence:CCGGGCTTCAAACTAAATTGGATGACTCGAGTCATCCAATTTAGTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008801.2-527s1c1
Sequence:CCGGCAATGTCATCATAGAGACAAACTCGAGTTTGTCTCTATGATGACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008801.2-924s21c1
Sequence:CCGGGCTTTCTTTAGCCTCTGGTTTCTCGAGAAACCAGAGGCTAAAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-530s21c1
Sequence:CCGGTGTCATCATAGAGACAAAGTTCTCGAGAACTTTGTCTCTATGATGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-193s21c1
Sequence:CCGGGCTTCAAACTAAATTGGATGACTCGAGTCATCCAATTTAGTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-414s21c1
Sequence:CCGGGAAGAGTGGTTCTTCGAGTTTCTCGAGAAACTCGAAGAACCACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008801
VALIDATED
PDE6D MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6D, cGMP-specific, rod, delta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-924s1c1
Sequence:CCGGGCTTTCTTTAGCCTCTGGTTTCTCGAGAAACCAGAGGCTAAAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-414s1c1
Sequence:CCGGGAAGAGTGGTTCTTCGAGTTTCTCGAGAAACTCGAAGAACCACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008801.2-530s1c1
Sequence:CCGGTGTCATCATAGAGACAAAGTTCTCGAGAACTTTGTCTCTATGATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-193s1c1
Sequence:CCGGGCTTCAAACTAAATTGGATGACTCGAGTCATCCAATTTAGTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008801.2-527s1c1
Sequence:CCGGCAATGTCATCATAGAGACAAACTCGAGTTTGTCTCTATGATGACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008801.2-924s21c1
Sequence:CCGGGCTTTCTTTAGCCTCTGGTTTCTCGAGAAACCAGAGGCTAAAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-530s21c1
Sequence:CCGGTGTCATCATAGAGACAAAGTTCTCGAGAACTTTGTCTCTATGATGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-193s21c1
Sequence:CCGGGCTTCAAACTAAATTGGATGACTCGAGTCATCCAATTTAGTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-414s21c1
Sequence:CCGGGAAGAGTGGTTCTTCGAGTTTCTCGAGAAACTCGAAGAACCACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008801
VALIDATED
PDE6D MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6D, cGMP-specific, rod, delta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-924s1c1
Sequence:CCGGGCTTTCTTTAGCCTCTGGTTTCTCGAGAAACCAGAGGCTAAAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-414s1c1
Sequence:CCGGGAAGAGTGGTTCTTCGAGTTTCTCGAGAAACTCGAAGAACCACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008801.2-530s1c1
Sequence:CCGGTGTCATCATAGAGACAAAGTTCTCGAGAACTTTGTCTCTATGATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008801.2-193s1c1
Sequence:CCGGGCTTCAAACTAAATTGGATGACTCGAGTCATCCAATTTAGTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008801.2-527s1c1
Sequence:CCGGCAATGTCATCATAGAGACAAACTCGAGTTTGTCTCTATGATGACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008801.2-924s21c1
Sequence:CCGGGCTTTCTTTAGCCTCTGGTTTCTCGAGAAACCAGAGGCTAAAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-530s21c1
Sequence:CCGGTGTCATCATAGAGACAAAGTTCTCGAGAACTTTGTCTCTATGATGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-193s21c1
Sequence:CCGGGCTTCAAACTAAATTGGATGACTCGAGTCATCCAATTTAGTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008801.2-414s21c1
Sequence:CCGGGAAGAGTGGTTCTTCGAGTTTCTCGAGAAACTCGAAGAACCACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002601
VALIDATED
PDE6D MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6D, cGMP-specific, rod, delta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002601.1-572s1c1
Sequence:CCGGGCACATCCAGAGTGAGACTTTCTCGAGAAAGTCTCACTCTGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-402s1c1
Sequence:CCGGGCAATGCCTAGAAGAATGGTTCTCGAGAACCATTCTTCTAGGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-439s1c1
Sequence:CCGGGTGATCCCTAACTCCACAAATCTCGAGATTTGTGGAGTTAGGGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-229s1c1
Sequence:CCGGACAGGGAAGATACTCTGGCAACTCGAGTTGCCAGAGTATCTTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-500s21c1
Sequence:CCGGTGATGCCAGCAAGCGTCTTAACTCGAGTTAAGACGCTTGCTGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002601.2-439s21c1
Sequence:CCGGGTGATCCCTAACTCCACAAATCTCGAGATTTGTGGAGTTAGGGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-402s21c1
Sequence:CCGGGCAATGCCTAGAAGAATGGTTCTCGAGAACCATTCTTCTAGGCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-572s21c1
Sequence:CCGGGCACATCCAGAGTGAGACTTTCTCGAGAAAGTCTCACTCTGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-796s21c1
Sequence:CCGGTTCCAGCTGACCAGACTAAACCTCGAGGTTTAGTCTGGTCAGCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002601
VALIDATED
PDE6D MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6D, cGMP-specific, rod, delta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002601.1-572s1c1
Sequence:CCGGGCACATCCAGAGTGAGACTTTCTCGAGAAAGTCTCACTCTGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-402s1c1
Sequence:CCGGGCAATGCCTAGAAGAATGGTTCTCGAGAACCATTCTTCTAGGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-439s1c1
Sequence:CCGGGTGATCCCTAACTCCACAAATCTCGAGATTTGTGGAGTTAGGGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-229s1c1
Sequence:CCGGACAGGGAAGATACTCTGGCAACTCGAGTTGCCAGAGTATCTTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-500s21c1
Sequence:CCGGTGATGCCAGCAAGCGTCTTAACTCGAGTTAAGACGCTTGCTGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002601.2-439s21c1
Sequence:CCGGGTGATCCCTAACTCCACAAATCTCGAGATTTGTGGAGTTAGGGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-402s21c1
Sequence:CCGGGCAATGCCTAGAAGAATGGTTCTCGAGAACCATTCTTCTAGGCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-572s21c1
Sequence:CCGGGCACATCCAGAGTGAGACTTTCTCGAGAAAGTCTCACTCTGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-796s21c1
Sequence:CCGGTTCCAGCTGACCAGACTAAACCTCGAGGTTTAGTCTGGTCAGCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002601
VALIDATED
PDE6D MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6D, cGMP-specific, rod, delta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002601.1-572s1c1
Sequence:CCGGGCACATCCAGAGTGAGACTTTCTCGAGAAAGTCTCACTCTGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-402s1c1
Sequence:CCGGGCAATGCCTAGAAGAATGGTTCTCGAGAACCATTCTTCTAGGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-439s1c1
Sequence:CCGGGTGATCCCTAACTCCACAAATCTCGAGATTTGTGGAGTTAGGGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002601.1-229s1c1
Sequence:CCGGACAGGGAAGATACTCTGGCAACTCGAGTTGCCAGAGTATCTTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-500s21c1
Sequence:CCGGTGATGCCAGCAAGCGTCTTAACTCGAGTTAAGACGCTTGCTGGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002601.2-439s21c1
Sequence:CCGGGTGATCCCTAACTCCACAAATCTCGAGATTTGTGGAGTTAGGGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-402s21c1
Sequence:CCGGGCAATGCCTAGAAGAATGGTTCTCGAGAACCATTCTTCTAGGCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-572s21c1
Sequence:CCGGGCACATCCAGAGTGAGACTTTCTCGAGAAAGTCTCACTCTGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296661    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002601.2-796s21c1
Sequence:CCGGTTCCAGCTGACCAGACTAAACCTCGAGGTTTAGTCTGGTCAGCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)