EMAIL THIS PAGE TO A FRIEND

PDE6G

phosphodiesterase 6G, cGMP-specific, rod, gamma

53 Gene Product Result for
Synonyms: PDEG RP57
UniProtKB ID: P18545, Q3KP63, Q7Z3U8
Gene ID:
Human(5148) Summary: This gene encodes the gamma subunit of cyclic GMP-phosphodiesterase, which is composed of alpha- and beta- catalytic subunits and two identical, inhibitory gamma subunits. This gene is expressed in rod photoreceptors and functions in the phototransduction signaling cascade. It is also expressed in a variety of other tissues, and has been shown to regulate the c-Src protein kinase and G-protein-coupled receptor kinase 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2009]
Mouse(18588) phosphodiesterase 6G, cGMP-specific, rod, gamma
Rat(688297) phosphodiesterase 6G, cGMP-specific, rod, gamma
Zebrafish(554700) phosphodiesterase 6G, cGMP-specific, rod, gamma
chicken(395091) phosphodiesterase 6G, cGMP-specific, rod, gamma
domestic cat(101088443) phosphodiesterase 6G, cGMP-specific, rod, gamma
dog(403911) phosphodiesterase 6G, cGMP-specific, rod, gamma
cow(281977) phosphodiesterase 6G, cGMP-specific, rod, gamma
sheep(101117520) phosphodiesterase 6G, cGMP-specific, rod, gamma
naked mole-rat(101705352) phosphodiesterase 6G, cGMP-specific, rod, gamma
domestic guinea pig(100135595) phosphodiesterase 6G, cGMP-specific, rod, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002602 Rosetta Predictions human pricing
XM_001081804 Rosetta Predictions rat pricing
XM_001081805 Rosetta Predictions rat pricing
NM_012065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134140 predicted 505
2 SASI_Hs01_00134141 predicted 493
3 SASI_Hs01_00134142 predicted 264
4 SASI_Hs01_00134143 predicted 651
5 SASI_Hs01_00134146 predicted 691
6 SASI_Hs01_00134147 predicted 407
7 SASI_Hs02_00334113 predicted 436
8 SASI_Hs02_00334114 predicted 407
9 SASI_Hs01_00134148 predicted 510
10 SASI_Hs02_00334115 predicted 257
11 SASI_Hs01_00134144 predicted 826
12 SASI_Hs01_00134145 predicted 284
13 SASI_Hs01_00134149 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373572 predicted 531
2 SASI_Rn02_00373573 predicted 275
3 SASI_Rn02_00373574 predicted 276
4 SASI_Rn02_00373575 predicted 273
5 SASI_Rn02_00373576 predicted 471
6 SASI_Rn02_00373577 predicted 341
7 SASI_Rn02_00373578 predicted 247
8 SASI_Rn02_00373579 predicted 597
9 SASI_Rn02_00373580 predicted 420
10 SASI_Rn02_00373581 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373582 predicted 473
2 SASI_Rn02_00373583 predicted 212
3 SASI_Rn02_00373584 predicted 407
4 SASI_Rn02_00373585 predicted 282
5 SASI_Rn02_00373586 predicted 532
6 SASI_Rn02_00373587 predicted 428
7 SASI_Rn02_00373588 predicted 362
8 SASI_Rn02_00373589 predicted 579
9 SASI_Rn02_00373590 predicted 310
10 SASI_Rn02_00373591 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322045 predicted 586
2 SASI_Mm01_00073026 predicted 585
3 SASI_Mm01_00073027 predicted 492
4 SASI_Mm01_00073028 predicted 239
5 SASI_Mm01_00073030 predicted 237
6 SASI_Mm01_00073031 predicted 580
7 SASI_Mm01_00073032 predicted 228
8 SASI_Mm01_00073033 predicted 595
9 SASI_Mm01_00073034 predicted 565
10 SASI_Mm01_00073035 predicted 583
11 SASI_Mm01_00073029 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002602
PDE6G MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6G, cGMP-specific, rod, gamma
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002602.3-871s21c1
Sequence:CCGGGTGCCCTTAGTTTGGACATGCCTCGAGGCATGTCCAAACTAAGGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002602.3-275s21c1
Sequence:CCGGAGAAAGGCGTTCAAGGGTTTGCTCGAGCAAACCCTTGAACGCCTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002602.1-579s1c1
Sequence:CCGGCCTGCTCAACATCTGGAGATACTCGAGTATCTCCAGATGTTGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-343s1c1
Sequence:CCGGGCTGGCCCAATATGGCATCATCTCGAGATGATGCCATATTGGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-199s1c1
Sequence:CCGGGCGACAGACCAGGCAGTTCAACTCGAGTTGAACTGCCTGGTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-285s1c1
Sequence:CCGGGAACAGACATCACAGTCATCTCTCGAGAGATGACTGTGATGTCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-184s1c2
Sequence:CCGGCCCTAAATTTAAGCAGCGACACTCGAGTGTCGCTGCTTAAATTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002602
PDE6G MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6G, cGMP-specific, rod, gamma
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002602.3-871s21c1
Sequence:CCGGGTGCCCTTAGTTTGGACATGCCTCGAGGCATGTCCAAACTAAGGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002602.3-275s21c1
Sequence:CCGGAGAAAGGCGTTCAAGGGTTTGCTCGAGCAAACCCTTGAACGCCTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002602.1-579s1c1
Sequence:CCGGCCTGCTCAACATCTGGAGATACTCGAGTATCTCCAGATGTTGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-343s1c1
Sequence:CCGGGCTGGCCCAATATGGCATCATCTCGAGATGATGCCATATTGGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-199s1c1
Sequence:CCGGGCGACAGACCAGGCAGTTCAACTCGAGTTGAACTGCCTGGTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-285s1c1
Sequence:CCGGGAACAGACATCACAGTCATCTCTCGAGAGATGACTGTGATGTCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-184s1c2
Sequence:CCGGCCCTAAATTTAAGCAGCGACACTCGAGTGTCGCTGCTTAAATTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002602
PDE6G MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6G, cGMP-specific, rod, gamma
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002602.3-871s21c1
Sequence:CCGGGTGCCCTTAGTTTGGACATGCCTCGAGGCATGTCCAAACTAAGGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002602.3-275s21c1
Sequence:CCGGAGAAAGGCGTTCAAGGGTTTGCTCGAGCAAACCCTTGAACGCCTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002602.1-579s1c1
Sequence:CCGGCCTGCTCAACATCTGGAGATACTCGAGTATCTCCAGATGTTGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-343s1c1
Sequence:CCGGGCTGGCCCAATATGGCATCATCTCGAGATGATGCCATATTGGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-199s1c1
Sequence:CCGGGCGACAGACCAGGCAGTTCAACTCGAGTTGAACTGCCTGGTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-285s1c1
Sequence:CCGGGAACAGACATCACAGTCATCTCTCGAGAGATGACTGTGATGTCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002602.1-184s1c2
Sequence:CCGGCCCTAAATTTAAGCAGCGACACTCGAGTGTCGCTGCTTAAATTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012065
PDE6G MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6G, cGMP-specific, rod, gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-188s1c1
Sequence:CCGGCCGGGTGATAGGAGGACCAGTCTCGAGACTGGTCCTCCTATCACCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-242s1c1
Sequence:CCGGGCGGCAAACAAGGCAGTTCAACTCGAGTTGAACTGCCTTGTTTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-388s1c1
Sequence:CCGGTGGCCCAGTATGGCATCATTTCTCGAGAAATGATGCCATACTGGGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-354s1c1
Sequence:CCGGTGGGAGGCCTTCAATCACCTACTCGAGTAGGTGATTGAAGGCCTCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-228s1c1
Sequence:CCGGCCTAAGTTTAAGCAGCGGCAACTCGAGTTGCCGCTGCTTAAACTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012065
PDE6G MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6G, cGMP-specific, rod, gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-188s1c1
Sequence:CCGGCCGGGTGATAGGAGGACCAGTCTCGAGACTGGTCCTCCTATCACCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-242s1c1
Sequence:CCGGGCGGCAAACAAGGCAGTTCAACTCGAGTTGAACTGCCTTGTTTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-388s1c1
Sequence:CCGGTGGCCCAGTATGGCATCATTTCTCGAGAAATGATGCCATACTGGGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-354s1c1
Sequence:CCGGTGGGAGGCCTTCAATCACCTACTCGAGTAGGTGATTGAAGGCCTCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-228s1c1
Sequence:CCGGCCTAAGTTTAAGCAGCGGCAACTCGAGTTGCCGCTGCTTAAACTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012065
PDE6G MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6G, cGMP-specific, rod, gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-188s1c1
Sequence:CCGGCCGGGTGATAGGAGGACCAGTCTCGAGACTGGTCCTCCTATCACCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-242s1c1
Sequence:CCGGGCGGCAAACAAGGCAGTTCAACTCGAGTTGAACTGCCTTGTTTGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-388s1c1
Sequence:CCGGTGGCCCAGTATGGCATCATTTCTCGAGAAATGATGCCATACTGGGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-354s1c1
Sequence:CCGGTGGGAGGCCTTCAATCACCTACTCGAGTAGGTGATTGAAGGCCTCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012065.2-228s1c1
Sequence:CCGGCCTAAGTTTAAGCAGCGGCAACTCGAGTTGCCGCTGCTTAAACTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)