EMAIL THIS PAGE TO A FRIEND

PDE6H

phosphodiesterase 6H, cGMP-specific, cone, gamma

71 Gene Product Result for
Synonyms: ACHM6 RCD3
UniProtKB ID: Q13956, Q52LY7
Gene ID:
Human(5149) Summary: This gene encodes the inhibitory (or gamma) subunit of the cone-specific cGMP phosphodiesterase, which is a tetramer composed of two catalytic chains (alpha and beta), and two inhibitory chains (gamma). It is specifically expressed in the retina, and is involved in the transmission and amplification of the visual signal. Mutations in this gene are associated with retinal cone dystrophy type 3A (RCD3A). [provided by RefSeq, Mar 2010]
Mouse(78600) phosphodiesterase 6H, cGMP-specific, cone, gamma
Rat(114248) phosphodiesterase 6H, cGMP-specific, cone, gamma
domestic guinea pig(100735374) phosphodiesterase 6H, cGMP-specific, cone, gamma
naked mole-rat(101717519) phosphodiesterase 6H, cGMP-specific, cone, gamma
cow(281978) phosphodiesterase 6H, cGMP-specific, cone, gamma
sheep(101105813) phosphodiesterase 6H, cGMP-specific, cone, gamma
Zebrafish(393758) phosphodiesterase 6H, cGMP-specific, cone, gamma
chicken(378929) phosphodiesterase 6H, cGMP-specific, cone, gamma
dog(611031) phosphodiesterase 6H, cGMP-specific, cone, gamma
domestic cat(101097496) phosphodiesterase 6H, cGMP-specific, cone, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045118 Anti-PDE6H antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing

Proteins

Product # Description Species Add to Cart
 
APREST94113 PrEST Antigen PDE6H Prestige Antigens Powered by Atlas Antibodies human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006081 MISSION® esiRNA esiRNA targeting human PDE6H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006205 Rosetta Predictions human pricing
NM_053688 Rosetta Predictions rat pricing
NM_023898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038835 predicted 492
2 SASI_Hs01_00038837 predicted 479
3 SASI_Hs01_00038838 predicted 204
4 SASI_Hs01_00038842 predicted 220
5 SASI_Hs01_00038843 predicted 481
6 SASI_Hs01_00038844 predicted 387
7 SASI_Hs02_00341105 predicted 456
8 SASI_Hs02_00341106 predicted 408
9 SASI_Hs02_00341107 predicted 467
10 SASI_Hs02_00341108 predicted 206
11 SASI_Hs01_00038836 predicted 314
12 SASI_Hs01_00038839 predicted 457
13 SASI_Hs01_00038840 predicted 251
14 SASI_Hs01_00038841 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096020 predicted 78
2 SASI_Rn01_00096022 predicted 221
3 SASI_Rn02_00266440 predicted 126
4 SASI_Rn02_00266441 predicted 83
5 SASI_Rn01_00096024 predicted 77
6 SASI_Rn01_00096025 predicted 83
7 SASI_Rn01_00096026 predicted 6
8 SASI_Rn02_00266442 predicted 72
9 SASI_Rn01_00096028 predicted 86
10 SASI_Rn01_00096029 predicted 221
11 SASI_Rn01_00096021 predicted 101
12 SASI_Rn01_00096023 predicted 92
13 SASI_Rn01_00096027 predicted 84
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029993 predicted 272
2 SASI_Mm01_00029990 predicted 318
3 SASI_Mm01_00029991 predicted 300
4 SASI_Mm01_00029992 predicted 315
5 SASI_Mm02_00327442 predicted 218
6 SASI_Mm01_00029994 predicted 315
7 SASI_Mm01_00029995 predicted 295
8 SASI_Mm01_00029996 predicted 289
9 SASI_Mm01_00029997 predicted 322
10 SASI_Mm01_00029998 predicted 311
11 SASI_Mm01_00029999 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006205
PDE6H MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6H, cGMP-specific, cone, gamma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006205.2-270s21c1
Sequence:CCGGGGCTAGGAACAGATATCACAGCTCGAGCTGTGATATCTGTTCCTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-174s1c1
Sequence:CCGGGACTCGCCAATTCAAGAGTAACTCGAGTTACTCTTGAATTGGCGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-196s1c1
Sequence:CCGGCCTCCAAAGAAAGGTGTGAAACTCGAGTTTCACACCTTTCTTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-222s1c1
Sequence:CCGGTGGAGATGACATTCCAGGAATCTCGAGATTCCTGGAATGTCATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-312s1c1
Sequence:CCGGGCTCGCTCAGTTTGGGATTATCTCGAGATAATCCCAAACTGAGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-270s1c1
Sequence:CCGGGATTTGTCCATGGGAGGCATTCTCGAGAATGCCTCCCATGGACAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006205.2-586s21c1
Sequence:CCGGGCTAGTTAGAAGTCATCAATACTCGAGTATTGATGACTTCTAACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006205.2-166s21c1
Sequence:CCGGCAAAGGCCCTCCCAAGTTCAACTCGAGTTGAACTTGGGAGGGCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006205
PDE6H MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6H, cGMP-specific, cone, gamma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006205.2-270s21c1
Sequence:CCGGGGCTAGGAACAGATATCACAGCTCGAGCTGTGATATCTGTTCCTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-174s1c1
Sequence:CCGGGACTCGCCAATTCAAGAGTAACTCGAGTTACTCTTGAATTGGCGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-196s1c1
Sequence:CCGGCCTCCAAAGAAAGGTGTGAAACTCGAGTTTCACACCTTTCTTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-222s1c1
Sequence:CCGGTGGAGATGACATTCCAGGAATCTCGAGATTCCTGGAATGTCATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-312s1c1
Sequence:CCGGGCTCGCTCAGTTTGGGATTATCTCGAGATAATCCCAAACTGAGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-270s1c1
Sequence:CCGGGATTTGTCCATGGGAGGCATTCTCGAGAATGCCTCCCATGGACAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006205.2-586s21c1
Sequence:CCGGGCTAGTTAGAAGTCATCAATACTCGAGTATTGATGACTTCTAACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006205.2-166s21c1
Sequence:CCGGCAAAGGCCCTCCCAAGTTCAACTCGAGTTGAACTTGGGAGGGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006205
PDE6H MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6H, cGMP-specific, cone, gamma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006205.2-270s21c1
Sequence:CCGGGGCTAGGAACAGATATCACAGCTCGAGCTGTGATATCTGTTCCTAGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-174s1c1
Sequence:CCGGGACTCGCCAATTCAAGAGTAACTCGAGTTACTCTTGAATTGGCGAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-196s1c1
Sequence:CCGGCCTCCAAAGAAAGGTGTGAAACTCGAGTTTCACACCTTTCTTTGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-222s1c1
Sequence:CCGGTGGAGATGACATTCCAGGAATCTCGAGATTCCTGGAATGTCATCTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-312s1c1
Sequence:CCGGGCTCGCTCAGTTTGGGATTATCTCGAGATAATCCCAAACTGAGCGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006205.1-270s1c1
Sequence:CCGGGATTTGTCCATGGGAGGCATTCTCGAGAATGCCTCCCATGGACAAATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006205.2-586s21c1
Sequence:CCGGGCTAGTTAGAAGTCATCAATACTCGAGTATTGATGACTTCTAACTAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000439256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006205.2-166s21c1
Sequence:CCGGCAAAGGCCCTCCCAAGTTCAACTCGAGTTGAACTTGGGAGGGCCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023898
PDE6H MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 6H, cGMP-specific, cone, gamma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-261s1c1
Sequence:CCGGAGGAACAGATATCACGGTCATCTCGAGATGACCGTGATATCTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-321s1c1
Sequence:CCGGGCTTGCTCAGTTCGGGATCATCTCGAGATGATCCCGAACTGAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-286s1c1
Sequence:CCGGCCCTGGGAAGCGTTCAGCCATCTCGAGATGGCTGAACGCTTCCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-174s1c1
Sequence:CCGGGCAGAGGCAGACTCGACAGTTCTCGAGAACTGTCGAGTCTGCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-183s1c1
Sequence:CCGGGACTCGACAGTTCAAGAGCAACTCGAGTTGCTCTTGAACTGTCGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023898
PDE6H MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 6H, cGMP-specific, cone, gamma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-261s1c1
Sequence:CCGGAGGAACAGATATCACGGTCATCTCGAGATGACCGTGATATCTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-321s1c1
Sequence:CCGGGCTTGCTCAGTTCGGGATCATCTCGAGATGATCCCGAACTGAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-286s1c1
Sequence:CCGGCCCTGGGAAGCGTTCAGCCATCTCGAGATGGCTGAACGCTTCCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-174s1c1
Sequence:CCGGGCAGAGGCAGACTCGACAGTTCTCGAGAACTGTCGAGTCTGCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-183s1c1
Sequence:CCGGGACTCGACAGTTCAAGAGCAACTCGAGTTGCTCTTGAACTGTCGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023898
PDE6H MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 6H, cGMP-specific, cone, gamma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-261s1c1
Sequence:CCGGAGGAACAGATATCACGGTCATCTCGAGATGACCGTGATATCTGTTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-321s1c1
Sequence:CCGGGCTTGCTCAGTTCGGGATCATCTCGAGATGATCCCGAACTGAGCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-286s1c1
Sequence:CCGGCCCTGGGAAGCGTTCAGCCATCTCGAGATGGCTGAACGCTTCCCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-174s1c1
Sequence:CCGGGCAGAGGCAGACTCGACAGTTCTCGAGAACTGTCGAGTCTGCCTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023898.3-183s1c1
Sequence:CCGGGACTCGACAGTTCAAGAGCAACTCGAGTTGCTCTTGAACTGTCGAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???