EMAIL THIS PAGE TO A FRIEND

PDE7A

phosphodiesterase 7A

130 Gene Product Result for
Synonyms: HCP1 PDE7
UniProtKB ID: Q13946, A0AVH6, A8K436, A8K9G5, O15380, Q96T72
Gene ID:
Human(5150) Summary: The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Mouse(18583) phosphodiesterase 7A
Rat(81744) phosphodiesterase 7A
Zebrafish(100151215) phosphodiesterase 7A
chicken(425199) phosphodiesterase 7A
dog(486975) phosphodiesterase 7A
domestic cat(101090414) phosphodiesterase 7A
Horse(100052450) phosphodiesterase 7A
cow(100849042) phosphodiesterase 7A
sheep(101120417) phosphodiesterase 7A
naked mole-rat(101719453) phosphodiesterase 7A
domestic guinea pig(100720311) phosphodiesterase 7A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002603 Rosetta Predictions human pricing
NM_002604 Rosetta Predictions human pricing
XM_001053781 Rosetta Predictions rat pricing
XM_001055271 Rosetta Predictions rat pricing
XM_001055326 Rosetta Predictions rat pricing
XM_215540 Rosetta Predictions rat pricing
NM_001122759 Rosetta Predictions mouse pricing
NM_008802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183420 predicted 880
2 SASI_Hs01_00183422 predicted 558
3 SASI_Hs01_00183423 predicted 592
4 SASI_Hs01_00183424 predicted 641
5 SASI_Hs01_00183425 predicted 844
6 SASI_Hs01_00183426 predicted 760
7 SASI_Hs01_00183427 predicted 638
8 SASI_Hs01_00183428 predicted 630
9 SASI_Hs01_00183429 predicted 544
10 SASI_Hs02_00334116 predicted 422
11 SASI_Hs01_00183421 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010481 predicted 804
2 SASI_Hs01_00010483 predicted 475
3 SASI_Hs01_00010484 predicted 512
4 SASI_Hs01_00010485 predicted 567
5 SASI_Hs01_00010486 predicted 769
6 SASI_Hs01_00010487 predicted 685
7 SASI_Hs01_00010488 predicted 562
8 SASI_Hs01_00010489 predicted 551
9 SASI_Hs01_00010490 predicted 465
10 SASI_Hs02_00334117 predicted 336
11 SASI_Hs01_00010482 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273532 predicted 912
2 SASI_Rn02_00273533 predicted 1074
3 SASI_Rn02_00273534 predicted 520
4 SASI_Rn02_00273535 predicted 813
5 SASI_Rn02_00273536 predicted 1262
6 SASI_Rn02_00273537 predicted 485
7 SASI_Rn02_00273538 predicted 728
8 SASI_Rn02_00273539 predicted 998
9 SASI_Rn02_00273540 predicted 1085
10 SASI_Rn02_00273541 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279046 predicted 908
2 SASI_Rn02_00279047 predicted 1083
3 SASI_Rn02_00279048 predicted 516
4 SASI_Rn02_00279049 predicted 805
5 SASI_Rn02_00279050 predicted 1259
6 SASI_Rn02_00279051 predicted 479
7 SASI_Rn02_00279052 predicted 727
8 SASI_Rn02_00279053 predicted 999
9 SASI_Rn02_00279054 predicted 1082
10 SASI_Rn02_00279055 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279217 predicted 1224
2 SASI_Rn02_00279218 predicted 1392
3 SASI_Rn02_00279219 predicted 830
4 SASI_Rn02_00279220 predicted 1116
5 SASI_Rn02_00279221 predicted 1568
6 SASI_Rn02_00279222 predicted 792
7 SASI_Rn02_00279223 predicted 1040
8 SASI_Rn02_00279224 predicted 1306
9 SASI_Rn02_00279225 predicted 1399
10 SASI_Rn02_00279226 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376065 predicted 1227
2 SASI_Rn02_00376066 predicted 1387
3 SASI_Rn02_00376067 predicted 832
4 SASI_Rn02_00376068 predicted 1122
5 SASI_Rn02_00376069 predicted 1568
6 SASI_Rn02_00376070 predicted 793
7 SASI_Rn02_00376071 predicted 1035
8 SASI_Rn02_00376072 predicted 1311
9 SASI_Rn02_00376073 predicted 1397
10 SASI_Rn02_00376074 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309371 predicted 1092
2 SASI_Mm02_00309372 predicted 1389
3 SASI_Mm02_00309373 predicted 1255
4 SASI_Mm02_00309374 predicted 1564
5 SASI_Mm02_00309375 predicted 793
6 SASI_Mm02_00309376 predicted 1310
7 SASI_Mm02_00309377 predicted 1006
8 SASI_Mm02_00309378 predicted 1191
9 SASI_Mm02_00309379 predicted 865
10 SASI_Mm02_00309380 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089646 predicted 778
2 SASI_Mm01_00089647 predicted 1078
3 SASI_Mm01_00089648 predicted 940
4 SASI_Mm01_00089649 predicted 1264
5 SASI_Mm02_00314719 predicted 488
6 SASI_Mm01_00089650 predicted 1007
7 SASI_Mm01_00089652 predicted 699
8 SASI_Mm01_00089653 predicted 884
9 SASI_Mm01_00089654 predicted 558
10 SASI_Mm01_00089655 predicted 1234
11 SASI_Mm01_00089651 predicted 1085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002603
PDE7A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 7A
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-567s21c1
Sequence:CCGGGAAATAGTCTAGTAAGCTTAACTCGAGTTAAGCTTACTAGACTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-615s21c1
Sequence:CCGGTAATTGAGTACTTCCATTTAGCTCGAGCTAAATGGAAGTACTCAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1252s21c1
Sequence:CCGGTTTGGGTGTGAGTCCACTTTGCTCGAGCAAAGTGGACTCACACCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1274s21c1
Sequence:CCGGGATCGTCACACTGAATCTATTCTCGAGAATAGATTCAGTGTGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-638s21c1
Sequence:CCGGATGATGAAACTTCGTAGATTTCTCGAGAAATCTACGAAGTTTCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002603.2-1687s21c1
Sequence:CCGGTAATTGCAAGACCCGAACATACTCGAGTATGTTCGGGTCTTGCAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-788s21c1
Sequence:CCGGGATATCTTGCTGAGCTTAATTCTCGAGAATTAAGCTCAGCAAGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1165s21c1
Sequence:CCGGATGTCGGACGTGGGAATTAAGCTCGAGCTTAATTCCCACGTCCGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-925s21c1
Sequence:CCGGGAGATCTGCAGTGGGCTTATTCTCGAGAATAAGCCCACTGCAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-1083s1c1
Sequence:CCGGCCATTTGGATAGAGGTGATTTCTCGAGAAATCACCTCTATCCAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-870s21c1
Sequence:CCGGACCATTACTTGGCAACTTTATCTCGAGATAAAGTTGCCAAGTAATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-448s21c1
Sequence:CCGGTGCGGTTTCAAATTCCCTAAACTCGAGTTTAGGGAATTTGAAACCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-256s1c1
Sequence:CCGGGCATTATACATTCGTATGCTACTCGAGTAGCATACGAATGTATAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-298s1c1
Sequence:CCGGCGAGCAGGATTTGAATCAGAACTCGAGTTCTGATTCAAATCCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-1493s1c1
Sequence:CCGGCACAGTTATTACCTCAGGAAACTCGAGTTTCCTGAGGTAATAACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-408s1c2
Sequence:CCGGGCTACTAAGTTTCCAGCGATACTCGAGTATCGCTGGAAACTTAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002603.2-1654s21c1
Sequence:CCGGATTTCCTCTGTTGGATCATTTCTCGAGAAATGATCCAACAGAGGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-311s21c1
Sequence:CCGGAGAGGTTCTCACCCATATATTCTCGAGAATATATGGGTGAGAACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-733s21c1
Sequence:CCGGGGCCATGCACTGTTACTTAAACTCGAGTTTAAGTAACAGTGCATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002603
PDE7A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 7A
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-567s21c1
Sequence:CCGGGAAATAGTCTAGTAAGCTTAACTCGAGTTAAGCTTACTAGACTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-615s21c1
Sequence:CCGGTAATTGAGTACTTCCATTTAGCTCGAGCTAAATGGAAGTACTCAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1252s21c1
Sequence:CCGGTTTGGGTGTGAGTCCACTTTGCTCGAGCAAAGTGGACTCACACCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1274s21c1
Sequence:CCGGGATCGTCACACTGAATCTATTCTCGAGAATAGATTCAGTGTGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-638s21c1
Sequence:CCGGATGATGAAACTTCGTAGATTTCTCGAGAAATCTACGAAGTTTCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002603.2-1687s21c1
Sequence:CCGGTAATTGCAAGACCCGAACATACTCGAGTATGTTCGGGTCTTGCAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-788s21c1
Sequence:CCGGGATATCTTGCTGAGCTTAATTCTCGAGAATTAAGCTCAGCAAGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1165s21c1
Sequence:CCGGATGTCGGACGTGGGAATTAAGCTCGAGCTTAATTCCCACGTCCGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-925s21c1
Sequence:CCGGGAGATCTGCAGTGGGCTTATTCTCGAGAATAAGCCCACTGCAGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-1083s1c1
Sequence:CCGGCCATTTGGATAGAGGTGATTTCTCGAGAAATCACCTCTATCCAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-870s21c1
Sequence:CCGGACCATTACTTGGCAACTTTATCTCGAGATAAAGTTGCCAAGTAATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-448s21c1
Sequence:CCGGTGCGGTTTCAAATTCCCTAAACTCGAGTTTAGGGAATTTGAAACCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-256s1c1
Sequence:CCGGGCATTATACATTCGTATGCTACTCGAGTAGCATACGAATGTATAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-298s1c1
Sequence:CCGGCGAGCAGGATTTGAATCAGAACTCGAGTTCTGATTCAAATCCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-1493s1c1
Sequence:CCGGCACAGTTATTACCTCAGGAAACTCGAGTTTCCTGAGGTAATAACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-408s1c2
Sequence:CCGGGCTACTAAGTTTCCAGCGATACTCGAGTATCGCTGGAAACTTAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002603.2-1654s21c1
Sequence:CCGGATTTCCTCTGTTGGATCATTTCTCGAGAAATGATCCAACAGAGGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-311s21c1
Sequence:CCGGAGAGGTTCTCACCCATATATTCTCGAGAATATATGGGTGAGAACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-733s21c1
Sequence:CCGGGGCCATGCACTGTTACTTAAACTCGAGTTTAAGTAACAGTGCATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002603
PDE7A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 7A
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-567s21c1
Sequence:CCGGGAAATAGTCTAGTAAGCTTAACTCGAGTTAAGCTTACTAGACTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-615s21c1
Sequence:CCGGTAATTGAGTACTTCCATTTAGCTCGAGCTAAATGGAAGTACTCAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1252s21c1
Sequence:CCGGTTTGGGTGTGAGTCCACTTTGCTCGAGCAAAGTGGACTCACACCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1274s21c1
Sequence:CCGGGATCGTCACACTGAATCTATTCTCGAGAATAGATTCAGTGTGACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-638s21c1
Sequence:CCGGATGATGAAACTTCGTAGATTTCTCGAGAAATCTACGAAGTTTCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002603.2-1687s21c1
Sequence:CCGGTAATTGCAAGACCCGAACATACTCGAGTATGTTCGGGTCTTGCAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-788s21c1
Sequence:CCGGGATATCTTGCTGAGCTTAATTCTCGAGAATTAAGCTCAGCAAGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-1165s21c1
Sequence:CCGGATGTCGGACGTGGGAATTAAGCTCGAGCTTAATTCCCACGTCCGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-925s21c1
Sequence:CCGGGAGATCTGCAGTGGGCTTATTCTCGAGAATAAGCCCACTGCAGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-1083s1c1
Sequence:CCGGCCATTTGGATAGAGGTGATTTCTCGAGAAATCACCTCTATCCAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-870s21c1
Sequence:CCGGACCATTACTTGGCAACTTTATCTCGAGATAAAGTTGCCAAGTAATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-448s21c1
Sequence:CCGGTGCGGTTTCAAATTCCCTAAACTCGAGTTTAGGGAATTTGAAACCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-256s1c1
Sequence:CCGGGCATTATACATTCGTATGCTACTCGAGTAGCATACGAATGTATAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-298s1c1
Sequence:CCGGCGAGCAGGATTTGAATCAGAACTCGAGTTCTGATTCAAATCCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-1493s1c1
Sequence:CCGGCACAGTTATTACCTCAGGAAACTCGAGTTTCCTGAGGTAATAACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002603.1-408s1c2
Sequence:CCGGGCTACTAAGTTTCCAGCGATACTCGAGTATCGCTGGAAACTTAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002603.2-1654s21c1
Sequence:CCGGATTTCCTCTGTTGGATCATTTCTCGAGAAATGATCCAACAGAGGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-311s21c1
Sequence:CCGGAGAGGTTCTCACCCATATATTCTCGAGAATATATGGGTGAGAACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002603.2-733s21c1
Sequence:CCGGGGCCATGCACTGTTACTTAAACTCGAGTTTAAGTAACAGTGCATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008802
VALIDATED
PDE7A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 7A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-1220s21c1
Sequence:CCGGATCGTCAGACTGAGTCTATTGCTCGAGCAATAGACTCAGTCTGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-398s21c1
Sequence:CCGGTTTGTAGTTCTCTAGACATTTCTCGAGAAATGTCTAGAGAACTACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-179s21c1
Sequence:CCGGCTGATCAGACTGCGTTATATACTCGAGTATATAACGCAGTCTGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008802.2-147s21c1
Sequence:CCGGTAAGAGACGTGGAGCTATTTCCTCGAGGAAATAGCTCCACGTCTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008802.1-1552s1c1
Sequence:CCGGGCCAGCATTATCTATCAAGATCTCGAGATCTTGATAGATAATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-945s1c1
Sequence:CCGGGCTTTGATATTAGCCACGGATCTCGAGATCCGTGGCTAATATCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-177s1c1
Sequence:CCGGGCGTTATATATTCGTATGCTACTCGAGTAGCATACGAATATATAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-768s1c1
Sequence:CCGGCCAGGTGTTAATCAGCCGTTTCTCGAGAAACGGCTGATTAACACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-1414s1c1
Sequence:CCGGCACAGTTACTAACTCAGGAAACTCGAGTTTCCTGAGTTAGTAACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-1565s21c1
Sequence:CCGGGCCAGCATTATCTATCAAGATCTCGAGATCTTGATAGATAATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008802
VALIDATED
PDE7A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 7A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-1220s21c1
Sequence:CCGGATCGTCAGACTGAGTCTATTGCTCGAGCAATAGACTCAGTCTGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-398s21c1
Sequence:CCGGTTTGTAGTTCTCTAGACATTTCTCGAGAAATGTCTAGAGAACTACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-179s21c1
Sequence:CCGGCTGATCAGACTGCGTTATATACTCGAGTATATAACGCAGTCTGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008802.2-147s21c1
Sequence:CCGGTAAGAGACGTGGAGCTATTTCCTCGAGGAAATAGCTCCACGTCTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008802.1-1552s1c1
Sequence:CCGGGCCAGCATTATCTATCAAGATCTCGAGATCTTGATAGATAATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-945s1c1
Sequence:CCGGGCTTTGATATTAGCCACGGATCTCGAGATCCGTGGCTAATATCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-177s1c1
Sequence:CCGGGCGTTATATATTCGTATGCTACTCGAGTAGCATACGAATATATAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-768s1c1
Sequence:CCGGCCAGGTGTTAATCAGCCGTTTCTCGAGAAACGGCTGATTAACACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-1414s1c1
Sequence:CCGGCACAGTTACTAACTCAGGAAACTCGAGTTTCCTGAGTTAGTAACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-1565s21c1
Sequence:CCGGGCCAGCATTATCTATCAAGATCTCGAGATCTTGATAGATAATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008802
VALIDATED
PDE7A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 7A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-1220s21c1
Sequence:CCGGATCGTCAGACTGAGTCTATTGCTCGAGCAATAGACTCAGTCTGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-398s21c1
Sequence:CCGGTTTGTAGTTCTCTAGACATTTCTCGAGAAATGTCTAGAGAACTACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-179s21c1
Sequence:CCGGCTGATCAGACTGCGTTATATACTCGAGTATATAACGCAGTCTGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008802.2-147s21c1
Sequence:CCGGTAAGAGACGTGGAGCTATTTCCTCGAGGAAATAGCTCCACGTCTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008802.1-1552s1c1
Sequence:CCGGGCCAGCATTATCTATCAAGATCTCGAGATCTTGATAGATAATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-945s1c1
Sequence:CCGGGCTTTGATATTAGCCACGGATCTCGAGATCCGTGGCTAATATCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-177s1c1
Sequence:CCGGGCGTTATATATTCGTATGCTACTCGAGTAGCATACGAATATATAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-768s1c1
Sequence:CCGGCCAGGTGTTAATCAGCCGTTTCTCGAGAAACGGCTGATTAACACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008802.1-1414s1c1
Sequence:CCGGCACAGTTACTAACTCAGGAAACTCGAGTTTCCTGAGTTAGTAACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008802.2-1565s21c1
Sequence:CCGGGCCAGCATTATCTATCAAGATCTCGAGATCTTGATAGATAATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)