EMAIL THIS PAGE TO A FRIEND

PDE7B

phosphodiesterase 7B

254 Gene Product Result for
Synonyms: bA472E5.1
UniProtKB ID: Q9NP56, Q5W154
Gene ID:
Human(27115) Summary: The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a cAMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family.[provided by RefSeq, Apr 2009]
Mouse(29863) phosphodiesterase 7B
Rat(140929) phosphodiesterase 7B
domestic guinea pig(100527957) phosphodiesterase 7B
naked mole-rat(101716394) phosphodiesterase 7B
Domestic Rabbit(100348750) phosphodiesterase 7B
cow(522509) phosphodiesterase 7B
sheep(101111290) phosphodiesterase 7B
chicken(421692) phosphodiesterase 7B
Horse(100073178) phosphodiesterase 7B
domestic cat(101100392) phosphodiesterase 7B
dog(483996) phosphodiesterase 7B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B0936 BRL 50481 ≥98% (HPLC), solid human pricing
K2628 Ketotifen fumarate salt human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018945 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018945 Rosetta Predictions human pricing
NM_080894 Rosetta Predictions rat pricing
NM_013875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232647 predicted 681
2 SASI_Hs01_00232648 predicted 612
3 SASI_Hs01_00232649 predicted 1271
4 SASI_Hs01_00232651 predicted 455
5 SASI_Hs01_00232652 predicted 727
6 SASI_Hs02_00352407 predicted 459
7 SASI_Hs01_00232653 predicted 745
8 SASI_Hs01_00232655 predicted 699
9 SASI_Hs02_00352408 predicted 693
10 SASI_Hs01_00232656 predicted 584
11 SASI_Hs01_00232650 predicted 1251
12 SASI_Hs01_00232654 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053514 predicted 1109
2 SASI_Rn01_00053515 predicted 1100
3 SASI_Rn01_00053516 predicted 877
4 SASI_Rn01_00053517 predicted 230
5 SASI_Rn01_00053518 predicted 777
6 SASI_Rn01_00053519 predicted 446
7 SASI_Rn01_00053520 predicted 1060
8 SASI_Rn01_00053521 predicted 691
9 SASI_Rn01_00053522 predicted 427
10 SASI_Rn01_00053523 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116617 predicted 995
2 SASI_Mm02_00322890 predicted 1256
3 SASI_Mm01_00116619 predicted 1078
4 SASI_Mm01_00116620 predicted 1423
5 SASI_Mm01_00116621 predicted 453
6 SASI_Mm01_00116622 predicted 608
7 SASI_Mm01_00116623 predicted 694
8 SASI_Mm01_00116624 predicted 390
9 SASI_Mm01_00116625 predicted 828
10 SASI_Mm02_00322891 predicted 315
11 SASI_Mm01_00116618 predicted 1425
12 SASI_Mm01_00116626 predicted 1368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013875
PDE7B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 7B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013875.2-3533s1c1
Sequence:CCGGGCTCTCTGTTTCTCCTAATAACTCGAGTTATTAGGAGAAACAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-523s1c1
Sequence:CCGGCCATTCATTGACTTCCGTCTACTCGAGTAGACGGAAGTCAATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-1494s1c1
Sequence:CCGGCCCTAGCATACAAATTGGTTTCTCGAGAAACCAATTTGTATGCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-418s1c1
Sequence:CCGGGTCTTGTTTGAGAGCCCTGAACTCGAGTTCAGGGCTCTCAAACAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-538s1c1
Sequence:CCGGCGTCTACTTAACAATACAACACTCGAGTGTTGTATTGTTAAGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013875
PDE7B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 7B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013875.2-3533s1c1
Sequence:CCGGGCTCTCTGTTTCTCCTAATAACTCGAGTTATTAGGAGAAACAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-523s1c1
Sequence:CCGGCCATTCATTGACTTCCGTCTACTCGAGTAGACGGAAGTCAATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-1494s1c1
Sequence:CCGGCCCTAGCATACAAATTGGTTTCTCGAGAAACCAATTTGTATGCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-418s1c1
Sequence:CCGGGTCTTGTTTGAGAGCCCTGAACTCGAGTTCAGGGCTCTCAAACAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-538s1c1
Sequence:CCGGCGTCTACTTAACAATACAACACTCGAGTGTTGTATTGTTAAGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013875
PDE7B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 7B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013875.2-3533s1c1
Sequence:CCGGGCTCTCTGTTTCTCCTAATAACTCGAGTTATTAGGAGAAACAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-523s1c1
Sequence:CCGGCCATTCATTGACTTCCGTCTACTCGAGTAGACGGAAGTCAATGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-1494s1c1
Sequence:CCGGCCCTAGCATACAAATTGGTTTCTCGAGAAACCAATTTGTATGCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-418s1c1
Sequence:CCGGGTCTTGTTTGAGAGCCCTGAACTCGAGTTCAGGGCTCTCAAACAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013875.2-538s1c1
Sequence:CCGGCGTCTACTTAACAATACAACACTCGAGTGTTGTATTGTTAAGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018945
VALIDATED
PDE7B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 7B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-453s1c1
Sequence:CCGGCCTACTTAACAGTACAACATACTCGAGTATGTTGTACTGTTAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-1039s1c1
Sequence:CCGGCGATCTACAATTGGCATGCTTCTCGAGAAGCATGCCAATTGTAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018945.2-1407s1c1
Sequence:CCGGCCCTAGTATACAAATTGGTTTCTCGAGAAACCAATTTGTATACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-610s1c1
Sequence:CCGGGCAAGGCATATGCTCTCCAAACTCGAGTTTGGAGAGCATATGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-1250s1c1
Sequence:CCGGCCTTGAAGTGTGCTGACATTTCTCGAGAAATGTCAGCACACTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-1846s21c1
Sequence:CCGGTCAGCATTCGCTGCCGAAATGCTCGAGCATTTCGGCAGCGAATGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-517s21c1
Sequence:CCGGCTATTAAGCTTTCAAAGATACCTCGAGGTATCTTTGAAAGCTTAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-2092s21c1
Sequence:CCGGCTTAAGTGCAAGAGCACAAATCTCGAGATTTGTGCTCTTGCACTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-664s21c1
Sequence:CCGGTTGTTTGATCGCTTGACAAATCTCGAGATTTGTCAAGCGATCAAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-1193s21c1
Sequence:CCGGACCTCCACAATAAAGACTTAACTCGAGTTAAGTCTTTATTGTGGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-704s21c1
Sequence:CCGGTGTTGTGCCACCTCTTCAATACTCGAGTATTGAAGAGGTGGCACAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-1000s21c1
Sequence:CCGGGCAAACCTATATCAGAATATGCTCGAGCATATTCTGATATAGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-2120s21c1
Sequence:CCGGTGAGAGAAAGTACCTTCTATTCTCGAGAATAGAAGGTACTTTCTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018945
VALIDATED
PDE7B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 7B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-453s1c1
Sequence:CCGGCCTACTTAACAGTACAACATACTCGAGTATGTTGTACTGTTAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-1039s1c1
Sequence:CCGGCGATCTACAATTGGCATGCTTCTCGAGAAGCATGCCAATTGTAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018945.2-1407s1c1
Sequence:CCGGCCCTAGTATACAAATTGGTTTCTCGAGAAACCAATTTGTATACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-610s1c1
Sequence:CCGGGCAAGGCATATGCTCTCCAAACTCGAGTTTGGAGAGCATATGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-1250s1c1
Sequence:CCGGCCTTGAAGTGTGCTGACATTTCTCGAGAAATGTCAGCACACTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-1846s21c1
Sequence:CCGGTCAGCATTCGCTGCCGAAATGCTCGAGCATTTCGGCAGCGAATGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-517s21c1
Sequence:CCGGCTATTAAGCTTTCAAAGATACCTCGAGGTATCTTTGAAAGCTTAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-2092s21c1
Sequence:CCGGCTTAAGTGCAAGAGCACAAATCTCGAGATTTGTGCTCTTGCACTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-664s21c1
Sequence:CCGGTTGTTTGATCGCTTGACAAATCTCGAGATTTGTCAAGCGATCAAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-1193s21c1
Sequence:CCGGACCTCCACAATAAAGACTTAACTCGAGTTAAGTCTTTATTGTGGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-704s21c1
Sequence:CCGGTGTTGTGCCACCTCTTCAATACTCGAGTATTGAAGAGGTGGCACAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-1000s21c1
Sequence:CCGGGCAAACCTATATCAGAATATGCTCGAGCATATTCTGATATAGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-2120s21c1
Sequence:CCGGTGAGAGAAAGTACCTTCTATTCTCGAGAATAGAAGGTACTTTCTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018945
VALIDATED
PDE7B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 7B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-453s1c1
Sequence:CCGGCCTACTTAACAGTACAACATACTCGAGTATGTTGTACTGTTAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-1039s1c1
Sequence:CCGGCGATCTACAATTGGCATGCTTCTCGAGAAGCATGCCAATTGTAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018945.2-1407s1c1
Sequence:CCGGCCCTAGTATACAAATTGGTTTCTCGAGAAACCAATTTGTATACTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-610s1c1
Sequence:CCGGGCAAGGCATATGCTCTCCAAACTCGAGTTTGGAGAGCATATGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018945.2-1250s1c1
Sequence:CCGGCCTTGAAGTGTGCTGACATTTCTCGAGAAATGTCAGCACACTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-1846s21c1
Sequence:CCGGTCAGCATTCGCTGCCGAAATGCTCGAGCATTTCGGCAGCGAATGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-517s21c1
Sequence:CCGGCTATTAAGCTTTCAAAGATACCTCGAGGTATCTTTGAAAGCTTAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-2092s21c1
Sequence:CCGGCTTAAGTGCAAGAGCACAAATCTCGAGATTTGTGCTCTTGCACTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-664s21c1
Sequence:CCGGTTGTTTGATCGCTTGACAAATCTCGAGATTTGTCAAGCGATCAAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-1193s21c1
Sequence:CCGGACCTCCACAATAAAGACTTAACTCGAGTTAAGTCTTTATTGTGGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-704s21c1
Sequence:CCGGTGTTGTGCCACCTCTTCAATACTCGAGTATTGAAGAGGTGGCACAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018945.3-1000s21c1
Sequence:CCGGGCAAACCTATATCAGAATATGCTCGAGCATATTCTGATATAGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018945.3-2120s21c1
Sequence:CCGGTGAGAGAAAGTACCTTCTATTCTCGAGAATAGAAGGTACTTTCTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)