EMAIL THIS PAGE TO A FRIEND

PDE8B

phosphodiesterase 8B

104 Gene Product Result for
Synonyms: ADSD PPNAD3
Gene ID:
Human(8622) Summary: The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Mouse(218461) phosphodiesterase 8B
Rat(309962) phosphodiesterase 8B
domestic guinea pig(100722693) phosphodiesterase 8B
naked mole-rat(101712263) phosphodiesterase 8B
cow(100337124) phosphodiesterase 8B
cow(539768) phosphodiesterase 8B
sheep(101107286) phosphodiesterase 8B
Zebrafish(571011) phosphodiesterase 8B
domestic cat(101083652) phosphodiesterase 8B
Horse(100073273) phosphodiesterase 8B
dog(488939) phosphodiesterase 8B
chicken(427645) phosphodiesterase 8B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003719 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090981 MISSION® esiRNA esiRNA human PDE8B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029851 Rosetta Predictions human pricing
NM_001029852 Rosetta Predictions human pricing
NM_001029853 Rosetta Predictions human pricing
NM_001029854 Rosetta Predictions human pricing
NM_003719 Rosetta Predictions human pricing
NM_199268 Rosetta Predictions rat pricing
NM_172263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078028 predicted 1907
2 SASI_Hs01_00078029 predicted 2397
3 SASI_Hs01_00078030 predicted 2063
4 SASI_Hs01_00078031 predicted 2205
5 SASI_Hs01_00078032 predicted 2377
6 SASI_Hs01_00078033 predicted 2447
7 SASI_Hs02_00307525 predicted 2499
8 SASI_Hs01_00078034 predicted 2359
9 SASI_Hs01_00078035 predicted 1499
10 SASI_Hs02_00307526 predicted 1743
11 SASI_Hs01_00078036 predicted 2495
12 SASI_Hs01_00078037 predicted 2001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142631 predicted 2027
2 SASI_Hs01_00142632 predicted 2531
3 SASI_Hs01_00142633 predicted 2187
4 SASI_Hs01_00142634 predicted 2338
5 SASI_Hs01_00142635 predicted 2512
6 SASI_Hs01_00142636 predicted 2571
7 SASI_Hs02_00307527 predicted 2624
8 SASI_Hs01_00142637 predicted 2484
9 SASI_Hs01_00142638 predicted 1622
10 SASI_Hs02_00307528 predicted 1867
11 SASI_Hs01_00142639 predicted 2629
12 SASI_Hs01_00142640 predicted 2130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227984 predicted 2129
2 SASI_Hs01_00227985 predicted 2627
3 SASI_Hs01_00227986 predicted 2288
4 SASI_Hs01_00227987 predicted 2444
5 SASI_Hs01_00227988 predicted 2611
6 SASI_Hs01_00227989 predicted 2682
7 SASI_Hs02_00307529 predicted 2735
8 SASI_Hs01_00227990 predicted 2587
9 SASI_Hs01_00227991 predicted 1731
10 SASI_Hs02_00307530 predicted 1970
11 SASI_Hs01_00227992 predicted 2730
12 SASI_Hs01_00227993 predicted 2227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244524 predicted 2052
2 SASI_Hs01_00244525 predicted 2547
3 SASI_Hs01_00244526 predicted 2212
4 SASI_Hs01_00244527 predicted 2360
5 SASI_Hs01_00244528 predicted 2527
6 SASI_Hs01_00244529 predicted 2600
7 SASI_Hs02_00307531 predicted 2650
8 SASI_Hs01_00244530 predicted 2512
9 SASI_Hs01_00244531 predicted 1649
10 SASI_Hs02_00307532 predicted 1886
11 SASI_Hs01_00244532 predicted 2646
12 SASI_Hs01_00244533 predicted 2155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063463 predicted 2192
2 SASI_Hs01_00063464 predicted 2687
3 SASI_Hs01_00063465 predicted 2348
4 SASI_Hs01_00063466 predicted 2496
5 SASI_Hs01_00063467 predicted 2672
6 SASI_Hs01_00063468 predicted 2741
7 SASI_Hs02_00336146 predicted 2791
8 SASI_Hs01_00063469 predicted 2650
9 SASI_Hs01_00063470 predicted 1793
10 SASI_Hs02_00336147 predicted 2036
11 SASI_Hs01_00063471 predicted 2790
12 SASI_Hs01_00063472 predicted 2293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089722 predicted 1819
2 SASI_Rn01_00089723 predicted 1336
3 SASI_Rn02_00270165 predicted 1023
4 SASI_Rn01_00089725 predicted 921
5 SASI_Rn01_00089726 predicted 1218
6 SASI_Rn01_00089727 predicted 878
7 SASI_Rn01_00089728 predicted 402
8 SASI_Rn01_00089729 predicted 1064
9 SASI_Rn01_00089730 predicted 2052
10 SASI_Rn01_00089731 predicted 1344
11 SASI_Rn01_00089724 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343730 predicted 1048
2 SASI_Mm01_00066228 predicted 359
3 SASI_Mm01_00066229 predicted 1028
4 SASI_Mm01_00066230 predicted 2089
5 SASI_Mm01_00066232 predicted 1840
6 SASI_Mm01_00066233 predicted 577
7 SASI_Mm01_00066234 predicted 1948
8 SASI_Mm01_00066235 predicted 1404
9 SASI_Mm01_00066236 predicted 2191
10 SASI_Mm02_00343731 predicted 839
11 SASI_Mm01_00066227 predicted 1051
12 SASI_Mm01_00066231 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172263
PDE8B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 8B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172263.1-2478s1c1
Sequence:CCGGCCCAAACTTCATTTCCAGAAACTCGAGTTTCTGGAAATGAAGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-1045s1c1
Sequence:CCGGCCCATCACAAAGGTTATAAATCTCGAGATTTATAACCTTTGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-2277s1c1
Sequence:CCGGCGATAACTATAAACACTGGAACTCGAGTTCCAGTGTTTATAGTTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-1494s1c1
Sequence:CCGGGCAAGTGATTGAAGCCAACTACTCGAGTAGTTGGCTTCAATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-682s1c1
Sequence:CCGGGCCATAGAAATAACAAGTGATCTCGAGATCACTTGTTATTTCTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172263
PDE8B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 8B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172263.1-2478s1c1
Sequence:CCGGCCCAAACTTCATTTCCAGAAACTCGAGTTTCTGGAAATGAAGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-1045s1c1
Sequence:CCGGCCCATCACAAAGGTTATAAATCTCGAGATTTATAACCTTTGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-2277s1c1
Sequence:CCGGCGATAACTATAAACACTGGAACTCGAGTTCCAGTGTTTATAGTTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-1494s1c1
Sequence:CCGGGCAAGTGATTGAAGCCAACTACTCGAGTAGTTGGCTTCAATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-682s1c1
Sequence:CCGGGCCATAGAAATAACAAGTGATCTCGAGATCACTTGTTATTTCTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172263
PDE8B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 8B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172263.1-2478s1c1
Sequence:CCGGCCCAAACTTCATTTCCAGAAACTCGAGTTTCTGGAAATGAAGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-1045s1c1
Sequence:CCGGCCCATCACAAAGGTTATAAATCTCGAGATTTATAACCTTTGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-2277s1c1
Sequence:CCGGCGATAACTATAAACACTGGAACTCGAGTTCCAGTGTTTATAGTTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-1494s1c1
Sequence:CCGGGCAAGTGATTGAAGCCAACTACTCGAGTAGTTGGCTTCAATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172263.1-682s1c1
Sequence:CCGGGCCATAGAAATAACAAGTGATCTCGAGATCACTTGTTATTTCTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003719
PDE8B MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 8B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-770s1c1
Sequence:CCGGGCAGCATAATTGCTTGCTATACTCGAGTATAGCAAGCAATTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1257s1c1
Sequence:CCGGGCCTCATTCATTCAGATATAACTCGAGTTATATCTGAATGAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1172s1c1
Sequence:CCGGCGCTCAAGAAACTGTGTTGTACTCGAGTACAACACAGTTTCTTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1792s1c1
Sequence:CCGGCGGTTTGGAGTATGTGAGTTTCTCGAGAAACTCACATACTCCAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-2193s1c1
Sequence:CCGGGCGCCAGGCTATTATTGACATCTCGAGATGTCAATAATAGCCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-2165s21c1
Sequence:CCGGATATTGACAGGAACCATTATCCTCGAGGATAATGGTTCCTGTCAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003719.2-3140s21c1
Sequence:CCGGATCGATCTGAAGGATTCATAACTCGAGTTATGAATCCTTCAGATCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-1735s21c1
Sequence:CCGGTTGGAAGCCATTACGCATAAACTCGAGTTTATGCGTAATGGCTTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-1295s21c1
Sequence:CCGGCCATTGACGTGAAATCGATATCTCGAGATATCGATTTCACGTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003719
PDE8B MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 8B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-770s1c1
Sequence:CCGGGCAGCATAATTGCTTGCTATACTCGAGTATAGCAAGCAATTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1257s1c1
Sequence:CCGGGCCTCATTCATTCAGATATAACTCGAGTTATATCTGAATGAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1172s1c1
Sequence:CCGGCGCTCAAGAAACTGTGTTGTACTCGAGTACAACACAGTTTCTTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1792s1c1
Sequence:CCGGCGGTTTGGAGTATGTGAGTTTCTCGAGAAACTCACATACTCCAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-2193s1c1
Sequence:CCGGGCGCCAGGCTATTATTGACATCTCGAGATGTCAATAATAGCCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-2165s21c1
Sequence:CCGGATATTGACAGGAACCATTATCCTCGAGGATAATGGTTCCTGTCAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003719.2-3140s21c1
Sequence:CCGGATCGATCTGAAGGATTCATAACTCGAGTTATGAATCCTTCAGATCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-1735s21c1
Sequence:CCGGTTGGAAGCCATTACGCATAAACTCGAGTTTATGCGTAATGGCTTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-1295s21c1
Sequence:CCGGCCATTGACGTGAAATCGATATCTCGAGATATCGATTTCACGTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003719
PDE8B MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 8B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-770s1c1
Sequence:CCGGGCAGCATAATTGCTTGCTATACTCGAGTATAGCAAGCAATTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1257s1c1
Sequence:CCGGGCCTCATTCATTCAGATATAACTCGAGTTATATCTGAATGAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1172s1c1
Sequence:CCGGCGCTCAAGAAACTGTGTTGTACTCGAGTACAACACAGTTTCTTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-1792s1c1
Sequence:CCGGCGGTTTGGAGTATGTGAGTTTCTCGAGAAACTCACATACTCCAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003719.1-2193s1c1
Sequence:CCGGGCGCCAGGCTATTATTGACATCTCGAGATGTCAATAATAGCCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-2165s21c1
Sequence:CCGGATATTGACAGGAACCATTATCCTCGAGGATAATGGTTCCTGTCAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003719.2-3140s21c1
Sequence:CCGGATCGATCTGAAGGATTCATAACTCGAGTTATGAATCCTTCAGATCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-1735s21c1
Sequence:CCGGTTGGAAGCCATTACGCATAAACTCGAGTTTATGCGTAATGGCTTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003719.2-1295s21c1
Sequence:CCGGCCATTGACGTGAAATCGATATCTCGAGATATCGATTTCACGTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)