EMAIL THIS PAGE TO A FRIEND

PDE9A

phosphodiesterase 9A

264 Gene Product Result for
Synonyms: HSPDE9A2
Gene ID:
Human(5152) Summary: The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18585) phosphodiesterase 9A
Rat(191569) phosphodiesterase 9A
Zebrafish(799942) phosphodiesterase 9A
Horse(100057783) phosphodiesterase 9A
domestic cat(101093538) phosphodiesterase 9A
dog(611022) phosphodiesterase 9A
chicken(418538) phosphodiesterase 9A
cow(511665) phosphodiesterase 9A
sheep(101121743) phosphodiesterase 9A
naked mole-rat(101707431) phosphodiesterase 9A
domestic guinea pig(100302673) phosphodiesterase 9A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145961 MISSION® esiRNA esiRNA human PDE9A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001567 Rosetta Predictions human pricing
NM_001001568 Rosetta Predictions human pricing
NM_001001569 Rosetta Predictions human pricing
NM_001001570 Rosetta Predictions human pricing
NM_001001571 Rosetta Predictions human pricing
NM_001001572 Rosetta Predictions human pricing
NM_001001573 Rosetta Predictions human pricing
NM_001001574 Rosetta Predictions human pricing
NM_001001575 Rosetta Predictions human pricing
NM_001001576 Rosetta Predictions human pricing
NM_001001577 Rosetta Predictions human pricing
NM_001001578 Rosetta Predictions human pricing
NM_001001579 Rosetta Predictions human pricing
NM_001001580 Rosetta Predictions human pricing
NM_001001581 Rosetta Predictions human pricing
NM_001001582 Rosetta Predictions human pricing
NM_001001583 Rosetta Predictions human pricing
NM_001001584 Rosetta Predictions human pricing
NM_001001585 Rosetta Predictions human pricing
NM_002606 Rosetta Predictions human pricing
NM_138543 Rosetta Predictions rat pricing
NM_008804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124199 predicted 880
2 SASI_Hs01_00124200 predicted 880
3 SASI_Hs01_00124201 predicted 1375
4 SASI_Hs01_00124202 predicted 981
5 SASI_Hs01_00124203 predicted 1539
6 SASI_Hs01_00124205 predicted 837
7 SASI_Hs01_00124206 predicted 1551
8 SASI_Hs01_00124207 predicted 1540
9 SASI_Hs01_00124208 predicted 1101
10 SASI_Hs02_00303828 predicted 1309
11 SASI_Hs01_00124204 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194673 predicted 737
2 SASI_Hs01_00194674 predicted 725
3 SASI_Hs01_00194675 predicted 1220
4 SASI_Hs01_00194676 predicted 836
5 SASI_Hs01_00194677 predicted 1391
6 SASI_Hs01_00194679 predicted 692
7 SASI_Hs01_00194680 predicted 1406
8 SASI_Hs01_00194681 predicted 1393
9 SASI_Hs01_00194682 predicted 950
10 SASI_Hs02_00303829 predicted 1162
11 SASI_Hs01_00194678 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048510 predicted 679
2 SASI_Hs01_00048511 predicted 672
3 SASI_Hs01_00048512 predicted 1165
4 SASI_Hs01_00048513 predicted 780
5 SASI_Hs01_00048514 predicted 1334
6 SASI_Hs01_00048516 predicted 640
7 SASI_Hs01_00048517 predicted 1352
8 SASI_Hs01_00048518 predicted 1341
9 SASI_Hs01_00048519 predicted 898
10 SASI_Hs02_00303830 predicted 1100
11 SASI_Hs01_00048515 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022422 predicted 903
2 SASI_Hs01_00022423 predicted 894
3 SASI_Hs01_00022424 predicted 1393
4 SASI_Hs01_00022425 predicted 1007
5 SASI_Hs01_00022426 predicted 1561
6 SASI_Hs01_00022428 predicted 859
7 SASI_Hs01_00022429 predicted 1575
8 SASI_Hs01_00022430 predicted 1561
9 SASI_Hs01_00022431 predicted 1125
10 SASI_Hs02_00303831 predicted 1325
11 SASI_Hs01_00022427 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243602 predicted 808
2 SASI_Hs01_00243603 predicted 807
3 SASI_Hs01_00243604 predicted 1298
4 SASI_Hs01_00243605 predicted 915
5 SASI_Hs01_00243606 predicted 1467
6 SASI_Hs01_00243608 predicted 767
7 SASI_Hs01_00243609 predicted 1481
8 SASI_Hs01_00243610 predicted 1466
9 SASI_Hs01_00243611 predicted 1030
10 SASI_Hs02_00303832 predicted 1237
11 SASI_Hs01_00243607 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122798 predicted 688
2 SASI_Hs01_00122799 predicted 683
3 SASI_Hs01_00122800 predicted 1179
4 SASI_Hs01_00122801 predicted 795
5 SASI_Hs01_00122802 predicted 1351
6 SASI_Hs01_00122804 predicted 645
7 SASI_Hs01_00122805 predicted 1356
8 SASI_Hs01_00122806 predicted 1346
9 SASI_Hs01_00122807 predicted 903
10 SASI_Hs02_00303833 predicted 1113
11 SASI_Hs01_00122803 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042822 predicted 866
2 SASI_Hs01_00042823 predicted 860
3 SASI_Hs01_00042824 predicted 1357
4 SASI_Hs01_00042825 predicted 966
5 SASI_Hs01_00042826 predicted 1530
6 SASI_Hs01_00042828 predicted 829
7 SASI_Hs01_00042829 predicted 1544
8 SASI_Hs01_00042830 predicted 1526
9 SASI_Hs01_00042831 predicted 1084
10 SASI_Hs02_00303834 predicted 1299
11 SASI_Hs01_00042827 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182453 predicted 804
2 SASI_Hs01_00182454 predicted 796
3 SASI_Hs01_00182455 predicted 1294
4 SASI_Hs01_00182456 predicted 906
5 SASI_Hs01_00182457 predicted 1467
6 SASI_Hs01_00182459 predicted 760
7 SASI_Hs01_00182460 predicted 1472
8 SASI_Hs01_00182461 predicted 1464
9 SASI_Hs01_00182462 predicted 1024
10 SASI_Hs02_00303835 predicted 1227
11 SASI_Hs01_00182458 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138354 predicted 634
2 SASI_Hs01_00138355 predicted 629
3 SASI_Hs01_00138356 predicted 1127
4 SASI_Hs01_00138357 predicted 740
5 SASI_Hs01_00138358 predicted 1289
6 SASI_Hs01_00138360 predicted 588
7 SASI_Hs01_00138361 predicted 1303
8 SASI_Hs01_00138362 predicted 1297
9 SASI_Hs01_00138363 predicted 855
10 SASI_Hs02_00303836 predicted 1062
11 SASI_Hs01_00138359 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210876 predicted 596
2 SASI_Hs01_00210877 predicted 592
3 SASI_Hs01_00210878 predicted 1089
4 SASI_Hs01_00210879 predicted 692
5 SASI_Hs01_00210880 predicted 1255
6 SASI_Hs01_00210882 predicted 547
7 SASI_Hs01_00210883 predicted 1259
8 SASI_Hs01_00210884 predicted 1257
9 SASI_Hs01_00210885 predicted 812
10 SASI_Hs02_00303837 predicted 1024
11 SASI_Hs01_00210881 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201817 predicted 716
2 SASI_Hs01_00201818 predicted 710
3 SASI_Hs01_00201819 predicted 1207
4 SASI_Hs01_00201820 predicted 809
5 SASI_Hs01_00201821 predicted 1372
6 SASI_Hs01_00201823 predicted 670
7 SASI_Hs01_00201824 predicted 1382
8 SASI_Hs01_00201825 predicted 1371
9 SASI_Hs01_00201826 predicted 932
10 SASI_Hs02_00303838 predicted 1139
11 SASI_Hs01_00201822 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125554 predicted 761
2 SASI_Hs01_00125555 predicted 748
3 SASI_Hs01_00125556 predicted 1246
4 SASI_Hs01_00125557 predicted 855
5 SASI_Hs01_00125558 predicted 1412
6 SASI_Hs01_00125560 predicted 718
7 SASI_Hs01_00125561 predicted 1428
8 SASI_Hs01_00125562 predicted 1418
9 SASI_Hs01_00125563 predicted 977
10 SASI_Hs02_00303839 predicted 1180
11 SASI_Hs01_00125559 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114319 predicted 754
2 SASI_Hs01_00114320 predicted 740
3 SASI_Hs01_00114321 predicted 1239
4 SASI_Hs01_00114322 predicted 851
5 SASI_Hs01_00114323 predicted 1409
6 SASI_Hs01_00114325 predicted 710
7 SASI_Hs01_00114326 predicted 1423
8 SASI_Hs01_00114327 predicted 1410
9 SASI_Hs01_00114328 predicted 966
10 SASI_Hs02_00303840 predicted 1179
11 SASI_Hs01_00114324 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077978 predicted 545
2 SASI_Hs01_00077979 predicted 549
3 SASI_Hs01_00077980 predicted 1041
4 SASI_Hs01_00077981 predicted 651
5 SASI_Hs01_00077982 predicted 1208
6 SASI_Hs01_00077984 predicted 510
7 SASI_Hs01_00077985 predicted 1216
8 SASI_Hs01_00077986 predicted 1208
9 SASI_Hs01_00077987 predicted 766
10 SASI_Hs02_00303841 predicted 971
11 SASI_Hs01_00077983 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220196 predicted 915
2 SASI_Hs01_00220197 predicted 909
3 SASI_Hs01_00220198 predicted 1403
4 SASI_Hs01_00220199 predicted 1017
5 SASI_Hs01_00220200 predicted 1576
6 SASI_Hs01_00220202 predicted 875
7 SASI_Hs01_00220203 predicted 1579
8 SASI_Hs01_00220204 predicted 1568
9 SASI_Hs01_00220205 predicted 1129
10 SASI_Hs02_00303842 predicted 1341
11 SASI_Hs01_00220201 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129676 predicted 988
2 SASI_Hs01_00129677 predicted 982
3 SASI_Hs01_00129678 predicted 1479
4 SASI_Hs01_00129679 predicted 1093
5 SASI_Hs01_00129680 predicted 1648
6 SASI_Hs01_00129682 predicted 948
7 SASI_Hs01_00129683 predicted 1661
8 SASI_Hs01_00129684 predicted 1648
9 SASI_Hs01_00129685 predicted 1209
10 SASI_Hs02_00303843 predicted 1419
11 SASI_Hs01_00129681 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180397 predicted 988
2 SASI_Hs01_00180398 predicted 975
3 SASI_Hs01_00180399 predicted 1477
4 SASI_Hs01_00180400 predicted 1084
5 SASI_Hs01_00180401 predicted 1644
6 SASI_Hs01_00180403 predicted 946
7 SASI_Hs01_00180404 predicted 1659
8 SASI_Hs01_00180405 predicted 1639
9 SASI_Hs01_00180406 predicted 1205
10 SASI_Hs02_00303844 predicted 1411
11 SASI_Hs01_00180402 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060900 predicted 815
2 SASI_Hs01_00060901 predicted 803
3 SASI_Hs01_00060902 predicted 1298
4 SASI_Hs01_00060903 predicted 914
5 SASI_Hs01_00060904 predicted 1473
6 SASI_Hs01_00060906 predicted 768
7 SASI_Hs01_00060907 predicted 1485
8 SASI_Hs01_00060908 predicted 1466
9 SASI_Hs01_00060909 predicted 1030
10 SASI_Hs02_00303845 predicted 1233
11 SASI_Hs01_00060905 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208073 predicted 936
2 SASI_Hs01_00208074 predicted 934
3 SASI_Hs01_00208075 predicted 1423
4 SASI_Hs01_00208076 predicted 1035
5 SASI_Hs01_00208077 predicted 1590
6 SASI_Hs01_00208079 predicted 895
7 SASI_Hs01_00208080 predicted 1605
8 SASI_Hs01_00208081 predicted 1598
9 SASI_Hs01_00208082 predicted 1156
10 SASI_Hs02_00303846 predicted 1362
11 SASI_Hs01_00208078 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015847 predicted 1062
2 SASI_Hs01_00015848 predicted 1057
3 SASI_Hs01_00015849 predicted 1558
4 SASI_Hs01_00015850 predicted 1168
5 SASI_Hs01_00015851 predicted 1725
6 SASI_Hs01_00015853 predicted 1021
7 SASI_Hs01_00015854 predicted 1733
8 SASI_Hs01_00015855 predicted 1720
9 SASI_Hs01_00015856 predicted 1280
10 SASI_Hs02_00334119 predicted 1493
11 SASI_Hs01_00015852 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037588 predicted 440
2 SASI_Rn01_00037589 predicted 1542
3 SASI_Rn01_00037591 predicted 1395
4 SASI_Rn01_00037592 predicted 551
5 SASI_Rn01_00037593 predicted 607
6 SASI_Rn01_00037594 predicted 714
7 SASI_Rn01_00037595 predicted 278
8 SASI_Rn01_00037596 predicted 1365
9 SASI_Rn01_00037597 predicted 667
10 SASI_Rn02_00268182 predicted 1106
11 SASI_Rn01_00037590 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194168 predicted 410
2 SASI_Mm01_00194169 predicted 1661
3 SASI_Mm01_00194170 predicted 1618
4 SASI_Mm01_00194171 predicted 413
5 SASI_Mm01_00194172 predicted 1382
6 SASI_Mm01_00194173 predicted 370
7 SASI_Mm01_00194174 predicted 544
8 SASI_Mm01_00194175 predicted 1681
9 SASI_Mm01_00194176 predicted 1612
10 SASI_Mm01_00194177 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001567
VALIDATED
PDE9A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 9A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001567.1-962s21c1
Sequence:CCGGACAACACGTACCAGATCAATGCTCGAGCATTGATCTGGTACGTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001567.1-480s21c1
Sequence:CCGGGAAATGCAAGAGTGACATTAACTCGAGTTAATGTCACTCTTGCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001567.1-786s1c2
Sequence:CCGGCGTCCACGACAACTACAGAAACTCGAGTTTCTGTAGTTGTCGTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-1752s1c1
Sequence:CCGGTGGCACCACAAGACCATGTTTCTCGAGAAACATGGTCTTGTGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001567.1-1557s1c1
Sequence:CCGGCGCCATGAAAGAGTTACAGAACTCGAGTTCTGTAACTCTTTCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-443s1c1
Sequence:CCGGGCGTGGAATTGGAAGGACTAACTCGAGTTAGTCCTTCCAATTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-1546s1c1
Sequence:CCGGCGGATAGATGACGCCATGAAACTCGAGTTTCATGGCGTCATCTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001567
VALIDATED
PDE9A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 9A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001567.1-962s21c1
Sequence:CCGGACAACACGTACCAGATCAATGCTCGAGCATTGATCTGGTACGTGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001567.1-480s21c1
Sequence:CCGGGAAATGCAAGAGTGACATTAACTCGAGTTAATGTCACTCTTGCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001567.1-786s1c2
Sequence:CCGGCGTCCACGACAACTACAGAAACTCGAGTTTCTGTAGTTGTCGTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-1752s1c1
Sequence:CCGGTGGCACCACAAGACCATGTTTCTCGAGAAACATGGTCTTGTGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001567.1-1557s1c1
Sequence:CCGGCGCCATGAAAGAGTTACAGAACTCGAGTTCTGTAACTCTTTCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-443s1c1
Sequence:CCGGGCGTGGAATTGGAAGGACTAACTCGAGTTAGTCCTTCCAATTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-1546s1c1
Sequence:CCGGCGGATAGATGACGCCATGAAACTCGAGTTTCATGGCGTCATCTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001567
VALIDATED
PDE9A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 9A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001567.1-962s21c1
Sequence:CCGGACAACACGTACCAGATCAATGCTCGAGCATTGATCTGGTACGTGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001567.1-480s21c1
Sequence:CCGGGAAATGCAAGAGTGACATTAACTCGAGTTAATGTCACTCTTGCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001567.1-786s1c2
Sequence:CCGGCGTCCACGACAACTACAGAAACTCGAGTTTCTGTAGTTGTCGTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-1752s1c1
Sequence:CCGGTGGCACCACAAGACCATGTTTCTCGAGAAACATGGTCTTGTGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001567.1-1557s1c1
Sequence:CCGGCGCCATGAAAGAGTTACAGAACTCGAGTTCTGTAACTCTTTCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-443s1c1
Sequence:CCGGGCGTGGAATTGGAAGGACTAACTCGAGTTAGTCCTTCCAATTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001001567.1-1546s1c1
Sequence:CCGGCGGATAGATGACGCCATGAAACTCGAGTTTCATGGCGTCATCTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008804
PDE9A MISSION shRNA Bacterial Glycerol Stock
phosphodiesterase 9A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008804.2-1774s1c1
Sequence:CCGGGACCTGCTACAGACCATGTTTCTCGAGAAACATGGTCTGTAGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-631s1c1
Sequence:CCGGCCACCTTTGATGTCTGGCTTTCTCGAGAAAGCCAGACATCAAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-668s1c1
Sequence:CCGGGCTGAGCTGTTTAGAACATATCTCGAGATATGTTCTAAACAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-1365s1c1
Sequence:CCGGCGAGACAAAGTGACCAAAGCACTCGAGTGCTTTGGTCACTTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-1353s1c1
Sequence:CCGGCCATTCATGGACCGAGACAAACTCGAGTTTGTCTCGGTCCATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008804
PDE9A MISSION shRNA shRNA Plasmid DNA
phosphodiesterase 9A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008804.2-1774s1c1
Sequence:CCGGGACCTGCTACAGACCATGTTTCTCGAGAAACATGGTCTGTAGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-631s1c1
Sequence:CCGGCCACCTTTGATGTCTGGCTTTCTCGAGAAAGCCAGACATCAAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-668s1c1
Sequence:CCGGGCTGAGCTGTTTAGAACATATCTCGAGATATGTTCTAAACAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-1365s1c1
Sequence:CCGGCGAGACAAAGTGACCAAAGCACTCGAGTGCTTTGGTCACTTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-1353s1c1
Sequence:CCGGCCATTCATGGACCGAGACAAACTCGAGTTTGTCTCGGTCCATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008804
PDE9A MISSION shRNA Lentiviral Transduction Particles
phosphodiesterase 9A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008804.2-1774s1c1
Sequence:CCGGGACCTGCTACAGACCATGTTTCTCGAGAAACATGGTCTGTAGCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-631s1c1
Sequence:CCGGCCACCTTTGATGTCTGGCTTTCTCGAGAAAGCCAGACATCAAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-668s1c1
Sequence:CCGGGCTGAGCTGTTTAGAACATATCTCGAGATATGTTCTAAACAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-1365s1c1
Sequence:CCGGCGAGACAAAGTGACCAAAGCACTCGAGTGCTTTGGTCACTTTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008804.2-1353s1c1
Sequence:CCGGCCATTCATGGACCGAGACAAACTCGAGTTTGTCTCGGTCCATGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)