EMAIL THIS PAGE TO A FRIEND

PDGFA

platelet-derived growth factor alpha polypeptide

133 Gene Product Result for
Synonyms: PDGF-A PDGF1
UniProtKB ID: P04085, B5BU73
Gene ID:
Human(5154) Summary: The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a motif of eight cysteines. This gene product can exist either as a homodimer or as a heterodimer with the platelet-derived growth factor beta polypeptide, where the dimers are connected by disulfide bonds. Studies using knockout mice have shown cellular defects in oligodendrocytes, alveolar smooth muscle cells, and Leydig cells in the testis; knockout mice die either as embryos or shortly after birth. Two splice variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(18590) platelet derived growth factor, alpha
Rat(25266) platelet-derived growth factor alpha polypeptide
chicken(374196) platelet-derived growth factor alpha polypeptide
domestic cat(101087287) platelet-derived growth factor alpha polypeptide
dog(491597) platelet-derived growth factor alpha polypeptide
naked mole-rat(101725739) platelet-derived growth factor alpha polypeptide
cow(505908) platelet-derived growth factor alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S2671 Suramin sodium salt ≥99% (TLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033023 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002607 Rosetta Predictions human pricing
NM_033023 Rosetta Predictions human pricing
NM_012801 Rosetta Predictions rat pricing
NM_008808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071680 predicted 881
2 SASI_Hs01_00071673 predicted 869
3 SASI_Hs01_00071674 predicted 978
4 SASI_Hs01_00071675 predicted 988
5 SASI_Hs01_00071677 predicted 1046
6 SASI_Hs01_00071678 predicted 1045
7 SASI_Hs01_00071676 predicted 1120
8 SASI_Hs02_00334120 predicted 1841
9 SASI_Hs01_00071681 predicted 1838
10 SASI_Hs01_00071682 predicted 1475
11 SASI_Hs01_00071679 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087167 predicted 886
2 SASI_Hs01_00087160 predicted 870
3 SASI_Hs01_00087161 predicted 983
4 SASI_Hs01_00087162 predicted 989
5 SASI_Hs01_00087164 predicted 1048
6 SASI_Hs01_00087165 predicted 1047
7 SASI_Hs01_00087163 predicted 1128
8 SASI_Hs02_00360700 predicted 1771
9 SASI_Hs01_00087168 predicted 1921
10 SASI_Hs01_00087169 predicted 1777
11 SASI_Hs01_00087166 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049626 predicted 565
2 SASI_Rn01_00049627 predicted 694
3 SASI_Rn01_00049628 predicted 895
4 SASI_Rn02_00260229 predicted 751
5 SASI_Rn01_00049629 predicted 750
6 SASI_Rn01_00049630 predicted 922
7 SASI_Rn01_00049631 predicted 931
8 SASI_Rn01_00049632 predicted 1000
9 SASI_Rn01_00049633 predicted 939
10 SASI_Rn01_00049634 predicted 1058
11 SASI_Rn01_00049635 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314732 predicted 648
2 SASI_Mm01_00169482 predicted 714
3 SASI_Mm02_00314733 predicted 444
4 SASI_Mm01_00169483 predicted 692
5 SASI_Mm01_00169485 predicted 624
6 SASI_Mm01_00169486 predicted 620
7 SASI_Mm02_00314734 predicted 444
8 SASI_Mm01_00169487 predicted 631
9 SASI_Mm01_00169489 predicted 426
10 SASI_Mm01_00169491 predicted 432
11 SASI_Mm01_00169484 predicted 456
12 SASI_Mm01_00169488 predicted 393
13 SASI_Mm01_00169490 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008808
VALIDATED
PDGFA MISSION shRNA Bacterial Glycerol Stock
platelet-derived growth factor alpha polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008808.3-470s21c1
Sequence:CCGGCAAGACCAGGACGGTCATTTACTCGAGTAAATGACCGTCCTGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008808.3-377s21c1
Sequence:CCGGCCATGGGTCCCATGCCATTAACTCGAGTTAATGGCATGGGACCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-820s21c1
Sequence:CCGGGACATTCCTGAACATACTATGCTCGAGCATAGTATGTTCAGGAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-427s21c1
Sequence:CCGGTTCGCAGGAAGAGAAGTATTGCTCGAGCAATACTTCTCTTCCTGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-313s21c1
Sequence:CCGGTCCAGCGACTCTTGGAGATAGCTCGAGCTATCTCCAAGAGTCGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008808.2-438s1c1
Sequence:CCGGAGAAGTATTGAGGAAGCCATTCTCGAGAATGGCTTCCTCAATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-425s1c1
Sequence:CCGGCATTCGCAGGAAGAGAAGTATCTCGAGATACTTCTCTTCCTGCGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-321s1c1
Sequence:CCGGCTCTTGGAGATAGACTCCGTACTCGAGTACGGAGTCTATCTCCAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-477s1c1
Sequence:CCGGAGGACGGTCATTTACGAGATACTCGAGTATCTCGTAAATGACCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008808.2-644s1c1
Sequence:CCGGAGTGGAGTATGTCAGGAAGAACTCGAGTTCTTCCTGACATACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008808
VALIDATED
PDGFA MISSION shRNA shRNA Plasmid DNA
platelet-derived growth factor alpha polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008808.3-470s21c1
Sequence:CCGGCAAGACCAGGACGGTCATTTACTCGAGTAAATGACCGTCCTGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008808.3-377s21c1
Sequence:CCGGCCATGGGTCCCATGCCATTAACTCGAGTTAATGGCATGGGACCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-820s21c1
Sequence:CCGGGACATTCCTGAACATACTATGCTCGAGCATAGTATGTTCAGGAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-427s21c1
Sequence:CCGGTTCGCAGGAAGAGAAGTATTGCTCGAGCAATACTTCTCTTCCTGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-313s21c1
Sequence:CCGGTCCAGCGACTCTTGGAGATAGCTCGAGCTATCTCCAAGAGTCGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008808.2-438s1c1
Sequence:CCGGAGAAGTATTGAGGAAGCCATTCTCGAGAATGGCTTCCTCAATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-425s1c1
Sequence:CCGGCATTCGCAGGAAGAGAAGTATCTCGAGATACTTCTCTTCCTGCGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-321s1c1
Sequence:CCGGCTCTTGGAGATAGACTCCGTACTCGAGTACGGAGTCTATCTCCAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-477s1c1
Sequence:CCGGAGGACGGTCATTTACGAGATACTCGAGTATCTCGTAAATGACCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008808.2-644s1c1
Sequence:CCGGAGTGGAGTATGTCAGGAAGAACTCGAGTTCTTCCTGACATACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008808
VALIDATED
PDGFA MISSION shRNA Lentiviral Transduction Particles
platelet-derived growth factor alpha polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008808.3-470s21c1
Sequence:CCGGCAAGACCAGGACGGTCATTTACTCGAGTAAATGACCGTCCTGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008808.3-377s21c1
Sequence:CCGGCCATGGGTCCCATGCCATTAACTCGAGTTAATGGCATGGGACCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-820s21c1
Sequence:CCGGGACATTCCTGAACATACTATGCTCGAGCATAGTATGTTCAGGAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-427s21c1
Sequence:CCGGTTCGCAGGAAGAGAAGTATTGCTCGAGCAATACTTCTCTTCCTGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008808.3-313s21c1
Sequence:CCGGTCCAGCGACTCTTGGAGATAGCTCGAGCTATCTCCAAGAGTCGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008808.2-438s1c1
Sequence:CCGGAGAAGTATTGAGGAAGCCATTCTCGAGAATGGCTTCCTCAATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-425s1c1
Sequence:CCGGCATTCGCAGGAAGAGAAGTATCTCGAGATACTTCTCTTCCTGCGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-321s1c1
Sequence:CCGGCTCTTGGAGATAGACTCCGTACTCGAGTACGGAGTCTATCTCCAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008808.2-477s1c1
Sequence:CCGGAGGACGGTCATTTACGAGATACTCGAGTATCTCGTAAATGACCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008808.2-644s1c1
Sequence:CCGGAGTGGAGTATGTCAGGAAGAACTCGAGTTCTTCCTGACATACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033023
PDGFA MISSION shRNA Bacterial Glycerol Stock
platelet-derived growth factor alpha polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1137s1c1
Sequence:CCGGCGGTCATTTACGAGATTCCTCCTCGAGGAGGAATCTCGTAAATGACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1297s1c1
Sequence:CCGGCAAGGTGGAATACGTCAGGAACTCGAGTTCCTGACGTATTCCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1002s1c1
Sequence:CCGGGTGAGGATTCTTTGGACACCACTCGAGTGGTGTCCAAAGAATCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1390s1c1
Sequence:CCGGGAATCCGGATTATCGGGAAGACTCGAGTCTTCCCGATAATCCGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1388s1c1
Sequence:CCGGCTGAATCCGGATTATCGGGAACTCGAGTTCCCGATAATCCGGATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1343s1c1
Sequence:CCGGGTGAGGTTAGAGGAGCATTTGCTCGAGCAAATGCTCCTCTAACCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1381s1c1
Sequence:CCGGCACAAGCCTGAATCCGGATTACTCGAGTAATCCGGATTCAGGCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1081s1c1
Sequence:CCGGCATTCGGAGGAAGAGAAGCATCTCGAGATGCTTCTCTTCCTCCGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1132s1c1
Sequence:CCGGCAGGACGGTCATTTACGAGATCTCGAGATCTCGTAAATGACCGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033023
PDGFA MISSION shRNA shRNA Plasmid DNA
platelet-derived growth factor alpha polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1137s1c1
Sequence:CCGGCGGTCATTTACGAGATTCCTCCTCGAGGAGGAATCTCGTAAATGACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1297s1c1
Sequence:CCGGCAAGGTGGAATACGTCAGGAACTCGAGTTCCTGACGTATTCCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1002s1c1
Sequence:CCGGGTGAGGATTCTTTGGACACCACTCGAGTGGTGTCCAAAGAATCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1390s1c1
Sequence:CCGGGAATCCGGATTATCGGGAAGACTCGAGTCTTCCCGATAATCCGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1388s1c1
Sequence:CCGGCTGAATCCGGATTATCGGGAACTCGAGTTCCCGATAATCCGGATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1343s1c1
Sequence:CCGGGTGAGGTTAGAGGAGCATTTGCTCGAGCAAATGCTCCTCTAACCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1381s1c1
Sequence:CCGGCACAAGCCTGAATCCGGATTACTCGAGTAATCCGGATTCAGGCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1081s1c1
Sequence:CCGGCATTCGGAGGAAGAGAAGCATCTCGAGATGCTTCTCTTCCTCCGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1132s1c1
Sequence:CCGGCAGGACGGTCATTTACGAGATCTCGAGATCTCGTAAATGACCGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033023
PDGFA MISSION shRNA Lentiviral Transduction Particles
platelet-derived growth factor alpha polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1137s1c1
Sequence:CCGGCGGTCATTTACGAGATTCCTCCTCGAGGAGGAATCTCGTAAATGACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1297s1c1
Sequence:CCGGCAAGGTGGAATACGTCAGGAACTCGAGTTCCTGACGTATTCCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1002s1c1
Sequence:CCGGGTGAGGATTCTTTGGACACCACTCGAGTGGTGTCCAAAGAATCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1390s1c1
Sequence:CCGGGAATCCGGATTATCGGGAAGACTCGAGTCTTCCCGATAATCCGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1388s1c1
Sequence:CCGGCTGAATCCGGATTATCGGGAACTCGAGTTCCCGATAATCCGGATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1343s1c1
Sequence:CCGGGTGAGGTTAGAGGAGCATTTGCTCGAGCAAATGCTCCTCTAACCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1381s1c1
Sequence:CCGGCACAAGCCTGAATCCGGATTACTCGAGTAATCCGGATTCAGGCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033023.1-1081s1c1
Sequence:CCGGCATTCGGAGGAAGAGAAGCATCTCGAGATGCTTCTCTTCCTCCGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033023.1-1132s1c1
Sequence:CCGGCAGGACGGTCATTTACGAGATCTCGAGATCTCGTAAATGACCGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)