EMAIL THIS PAGE TO A FRIEND

PDGFB

platelet-derived growth factor beta polypeptide

137 Gene Product Result for
Synonyms: PDGF-2 PDGF2 SIS SSV c-sis
UniProtKB ID: P01127, G3XAG8, P78431, Q15354, Q6FHE7, Q9UF23
Gene ID:
Human(5155) Summary: The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a motif of eight cysteines. This gene product can exist either as a homodimer (PDGF-BB) or as a heterodimer with the platelet-derived growth factor alpha polypeptide (PDGF-AB), where the dimers are connected by disulfide bonds. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans resulting from unregulated expression of growth factor. Two alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2013]
Mouse(18591) platelet derived growth factor, B polypeptide
Rat(24628) platelet-derived growth factor beta polypeptide
Zebrafish(565324) platelet derived growth factor, B polypeptide
dog(442986) platelet-derived growth factor beta polypeptide
chicken(374128) platelet-derived growth factor beta polypeptide
cow(540106) platelet-derived growth factor beta polypeptide
sheep(443545) platelet-derived growth factor beta polypeptide
domestic guinea pig(100731469) platelet-derived growth factor beta polypeptide
naked mole-rat(101698830) platelet-derived growth factor beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002608 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002608 Rosetta Predictions human pricing
NM_033016 Rosetta Predictions human pricing
NM_031524 Rosetta Predictions rat pricing
NM_011057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121961 predicted 1675
2 SASI_Hs01_00121962 predicted 1684
3 SASI_Hs01_00121963 predicted 1769
4 SASI_Hs01_00121964 predicted 1999
5 SASI_Hs01_00121965 predicted 2129
6 SASI_Hs01_00121966 predicted 1705
7 SASI_Hs01_00121967 predicted 2009
8 SASI_Hs01_00121968 predicted 1823
9 SASI_Hs01_00121969 predicted 1417
10 SASI_Hs01_00121970 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050284 predicted 681
2 SASI_Hs01_00050285 predicted 696
3 SASI_Hs01_00050286 predicted 776
4 SASI_Hs01_00050287 predicted 1008
5 SASI_Hs01_00050288 predicted 1137
6 SASI_Hs01_00050289 predicted 711
7 SASI_Hs01_00050290 predicted 1021
8 SASI_Hs01_00050291 predicted 826
9 SASI_Hs01_00050292 predicted 427
10 SASI_Hs01_00050293 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264656 predicted 1464
2 SASI_Rn02_00264657 predicted 1137
3 SASI_Rn02_00264658 predicted 1138
4 SASI_Rn02_00264659 predicted 789
5 SASI_Rn02_00264660 predicted 462
6 SASI_Rn02_00264661 predicted 1055
7 SASI_Rn02_00264662 predicted 954
8 SASI_Rn02_00264663 predicted 914
9 SASI_Rn02_00264664 predicted 664
10 SASI_Rn02_00264665 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131252 predicted 1771
2 SASI_Mm01_00131253 predicted 1553
3 SASI_Mm01_00131254 predicted 1469
4 SASI_Mm01_00131255 predicted 1535
5 SASI_Mm01_00131256 predicted 1556
6 SASI_Mm01_00131257 predicted 1950
7 SASI_Mm01_00131258 predicted 874
8 SASI_Mm02_00319813 predicted 1075
9 SASI_Mm01_00131259 predicted 1278
10 SASI_Mm01_00131260 predicted 1967
11 SASI_Mm01_00131261 predicted 1087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002608
VALIDATED
PDGFB MISSION shRNA Bacterial Glycerol Stock
platelet-derived growth factor beta polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1104s21c1
Sequence:CCGGCGCTCCTTTGATGATCTCCAACTCGAGTTGGAGATCATCAAAGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1162s21c1
Sequence:CCGGCCGAGTTGGACCTGAACATGACTCGAGTCATGTTCAGGTCCAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1442s21c1
Sequence:CCGGCCAGGTGAGAAAGATCGAGATCTCGAGATCTCGATCTTTCTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.1-1100s1c1
Sequence:CCGGCGAGGAGCTTTATGAGATGCTCTCGAGAGCATCTCATAAAGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.1-1137s1c1
Sequence:CCGGCGCTCCTTTGATGATCTCCAACTCGAGTTGGAGATCATCAAAGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.x-1195s1c1
Sequence:CCGGCCGAGTTGGACCTGAACATGACTCGAGTCATGTTCAGGTCCAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.x-1710s1c1
Sequence:CCGGTGACAAGACGGCACTGAAGGACTCGAGTCCTTCAGTGCCGTCTTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1067s21c1
Sequence:CCGGCGAGGAGCTTTATGAGATGCTCTCGAGAGCATCTCATAAAGCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002608
VALIDATED
PDGFB MISSION shRNA shRNA Plasmid DNA
platelet-derived growth factor beta polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1104s21c1
Sequence:CCGGCGCTCCTTTGATGATCTCCAACTCGAGTTGGAGATCATCAAAGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1162s21c1
Sequence:CCGGCCGAGTTGGACCTGAACATGACTCGAGTCATGTTCAGGTCCAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1442s21c1
Sequence:CCGGCCAGGTGAGAAAGATCGAGATCTCGAGATCTCGATCTTTCTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.1-1100s1c1
Sequence:CCGGCGAGGAGCTTTATGAGATGCTCTCGAGAGCATCTCATAAAGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.1-1137s1c1
Sequence:CCGGCGCTCCTTTGATGATCTCCAACTCGAGTTGGAGATCATCAAAGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.x-1195s1c1
Sequence:CCGGCCGAGTTGGACCTGAACATGACTCGAGTCATGTTCAGGTCCAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.x-1710s1c1
Sequence:CCGGTGACAAGACGGCACTGAAGGACTCGAGTCCTTCAGTGCCGTCTTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1067s21c1
Sequence:CCGGCGAGGAGCTTTATGAGATGCTCTCGAGAGCATCTCATAAAGCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002608
VALIDATED
PDGFB MISSION shRNA Lentiviral Transduction Particles
platelet-derived growth factor beta polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1104s21c1
Sequence:CCGGCGCTCCTTTGATGATCTCCAACTCGAGTTGGAGATCATCAAAGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1162s21c1
Sequence:CCGGCCGAGTTGGACCTGAACATGACTCGAGTCATGTTCAGGTCCAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1442s21c1
Sequence:CCGGCCAGGTGAGAAAGATCGAGATCTCGAGATCTCGATCTTTCTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.1-1100s1c1
Sequence:CCGGCGAGGAGCTTTATGAGATGCTCTCGAGAGCATCTCATAAAGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.1-1137s1c1
Sequence:CCGGCGCTCCTTTGATGATCTCCAACTCGAGTTGGAGATCATCAAAGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.x-1195s1c1
Sequence:CCGGCCGAGTTGGACCTGAACATGACTCGAGTCATGTTCAGGTCCAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002608.x-1710s1c1
Sequence:CCGGTGACAAGACGGCACTGAAGGACTCGAGTCCTTCAGTGCCGTCTTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002608.2-1067s21c1
Sequence:CCGGCGAGGAGCTTTATGAGATGCTCTCGAGAGCATCTCATAAAGCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011057
VALIDATED
PDGFB MISSION shRNA Bacterial Glycerol Stock
platelet-derived growth factor beta polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1339s21c1
Sequence:CCGGGCCTGCAAGTGTGAGACAGTACTCGAGTACTGTCTCACACTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011057.2-930s1c1
Sequence:CCGGCCAGGTGAGAAAGATTGAGATCTCGAGATCTCAATCTTTCTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-686s1c1
Sequence:CCGGGAGTCGAGTTGGAAAGCTCATCTCGAGATGAGCTTTCCAACTCGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-1006s1c1
Sequence:CCGGGCCTGCAAGTGTGAGACAGTACTCGAGTACTGTCTCACACTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-1152s1c1
Sequence:CCGGGTTTAAGCACACCCATGACAACTCGAGTTGTCATGGGTGTGCTTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-870s1c1
Sequence:CCGGCGGCTGCTGCAATAACCGCAACTCGAGTTGCGGTTATTGCAGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011057.3-1549s21c1
Sequence:CCGGGAGTGTGGGCAGGGTTATTTACTCGAGTAAATAACCCTGCCCACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-885s21c1
Sequence:CCGGTCCTGAGGAACTGTATGAAATCTCGAGATTTCATACAGTTCCTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1019s21c1
Sequence:CCGGGAGTCGAGTTGGAAAGCTCATCTCGAGATGAGCTTTCCAACTCGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1263s21c1
Sequence:CCGGCCAGGTGAGAAAGATTGAGATCTCGAGATCTCAATCTTTCTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011057
VALIDATED
PDGFB MISSION shRNA shRNA Plasmid DNA
platelet-derived growth factor beta polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1339s21c1
Sequence:CCGGGCCTGCAAGTGTGAGACAGTACTCGAGTACTGTCTCACACTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011057.2-930s1c1
Sequence:CCGGCCAGGTGAGAAAGATTGAGATCTCGAGATCTCAATCTTTCTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-686s1c1
Sequence:CCGGGAGTCGAGTTGGAAAGCTCATCTCGAGATGAGCTTTCCAACTCGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-1006s1c1
Sequence:CCGGGCCTGCAAGTGTGAGACAGTACTCGAGTACTGTCTCACACTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-1152s1c1
Sequence:CCGGGTTTAAGCACACCCATGACAACTCGAGTTGTCATGGGTGTGCTTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-870s1c1
Sequence:CCGGCGGCTGCTGCAATAACCGCAACTCGAGTTGCGGTTATTGCAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011057.3-1549s21c1
Sequence:CCGGGAGTGTGGGCAGGGTTATTTACTCGAGTAAATAACCCTGCCCACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-885s21c1
Sequence:CCGGTCCTGAGGAACTGTATGAAATCTCGAGATTTCATACAGTTCCTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1019s21c1
Sequence:CCGGGAGTCGAGTTGGAAAGCTCATCTCGAGATGAGCTTTCCAACTCGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1263s21c1
Sequence:CCGGCCAGGTGAGAAAGATTGAGATCTCGAGATCTCAATCTTTCTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011057
VALIDATED
PDGFB MISSION shRNA Lentiviral Transduction Particles
platelet-derived growth factor beta polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1339s21c1
Sequence:CCGGGCCTGCAAGTGTGAGACAGTACTCGAGTACTGTCTCACACTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011057.2-930s1c1
Sequence:CCGGCCAGGTGAGAAAGATTGAGATCTCGAGATCTCAATCTTTCTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-686s1c1
Sequence:CCGGGAGTCGAGTTGGAAAGCTCATCTCGAGATGAGCTTTCCAACTCGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-1006s1c1
Sequence:CCGGGCCTGCAAGTGTGAGACAGTACTCGAGTACTGTCTCACACTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-1152s1c1
Sequence:CCGGGTTTAAGCACACCCATGACAACTCGAGTTGTCATGGGTGTGCTTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011057.2-870s1c1
Sequence:CCGGCGGCTGCTGCAATAACCGCAACTCGAGTTGCGGTTATTGCAGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011057.3-1549s21c1
Sequence:CCGGGAGTGTGGGCAGGGTTATTTACTCGAGTAAATAACCCTGCCCACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-885s21c1
Sequence:CCGGTCCTGAGGAACTGTATGAAATCTCGAGATTTCATACAGTTCCTCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1019s21c1
Sequence:CCGGGAGTCGAGTTGGAAAGCTCATCTCGAGATGAGCTTTCCAACTCGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011057.3-1263s21c1
Sequence:CCGGCCAGGTGAGAAAGATTGAGATCTCGAGATCTCAATCTTTCTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)