EMAIL THIS PAGE TO A FRIEND

PDGFC

platelet derived growth factor C

96 Gene Product Result for
Synonyms: FALLOTEIN SCDGF
UniProtKB ID: Q9NRA1, B4DU34, B9EGR8, Q4W5M9, Q9UL22
Gene ID:
Human(56034) Summary: The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines. This gene product appears to form only homodimers. It differs from the platelet-derived growth factor alpha and beta polypeptides in having an unusual N-terminal domain, the CUB domain. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(54635) platelet-derived growth factor, C polypeptide
Rat(79429) platelet derived growth factor C
naked mole-rat(101710927) platelet derived growth factor C
domestic guinea pig(100722571) platelet derived growth factor C
cow(613787) platelet derived growth factor C
sheep(101112600) platelet derived growth factor C
chicken(395469) platelet derived growth factor C
domestic cat(101088742) platelet derived growth factor C
Horse(100062015) platelet derived growth factor C
dog(482666) platelet derived growth factor C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1630 Human PDGF-C ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016205 Rosetta Predictions human pricing
NM_031317 Rosetta Predictions rat pricing
NM_019971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349051 predicted 1147
2 SASI_Hs01_00203931 predicted 1052
3 SASI_Hs02_00349052 predicted 1259
4 SASI_Hs01_00203933 predicted 911
5 SASI_Hs01_00203934 predicted 704
6 SASI_Hs02_00349053 predicted 1368
7 SASI_Hs01_00203935 predicted 1571
8 SASI_Hs01_00203936 predicted 1066
9 SASI_Hs02_00349054 predicted 681
10 SASI_Hs01_00203937 predicted 1267
11 SASI_Hs01_00203932 predicted 1205
12 SASI_Hs01_00203938 predicted 786
13 SASI_Hs01_00203939 predicted 1597
14 SASI_Hs01_00203940 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058720 predicted 395
2 SASI_Rn01_00058721 predicted 258
3 SASI_Rn01_00058722 predicted 295
4 SASI_Rn01_00058723 predicted 421
5 SASI_Rn01_00058724 predicted 702
6 SASI_Rn01_00058725 predicted 849
7 SASI_Rn01_00058726 predicted 333
8 SASI_Rn01_00058727 predicted 218
9 SASI_Rn01_00058728 predicted 800
10 SASI_Rn01_00058729 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147383 predicted 1242
2 SASI_Mm01_00147384 predicted 1303
3 SASI_Mm01_00147385 predicted 1496
4 SASI_Mm02_00325272 predicted 1879
5 SASI_Mm01_00147386 predicted 1278
6 SASI_Mm01_00147387 predicted 1314
7 SASI_Mm01_00147389 predicted 1447
8 SASI_Mm02_00325273 predicted 1782
9 SASI_Mm01_00147390 predicted 1243
10 SASI_Mm01_00147391 predicted 1712
11 SASI_Mm01_00147382 predicted 1425
12 SASI_Mm01_00147388 predicted 1804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016205
VALIDATED
PDGFC MISSION shRNA Bacterial Glycerol Stock
platelet derived growth factor C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-681s21c1
Sequence:CCGGCCTCATACTTATCCAAGAAATCTCGAGATTTCTTGGATAAGTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-831s21c1
Sequence:CCGGCCCAGTGATGGAACTATATTACTCGAGTAATATAGTTCCATCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-1305s21c1
Sequence:CCGGCCAGGTTGTCTCCTGGTTAAACTCGAGTTTAACCAGGAGACAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016205.1-1608s1c1
Sequence:CCGGCCATCCTTAATCTCAGTTGTTCTCGAGAACAACTGAGATTAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-681s1c1
Sequence:CCGGCCTCATACTTATCCAAGAAATCTCGAGATTTCTTGGATAAGTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016205.1-831s1c1
Sequence:CCGGCCCAGTGATGGAACTATATTACTCGAGTAATATAGTTCCATCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-621s1c1
Sequence:CCGGCCTCAGCATGAGAGAATTATTCTCGAGAATAATTCTCTCATGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-1305s1c1
Sequence:CCGGCCAGGTTGTCTCCTGGTTAAACTCGAGTTTAACCAGGAGACAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-621s21c1
Sequence:CCGGCCTCAGCATGAGAGAATTATTCTCGAGAATAATTCTCTCATGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016205
VALIDATED
PDGFC MISSION shRNA shRNA Plasmid DNA
platelet derived growth factor C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-681s21c1
Sequence:CCGGCCTCATACTTATCCAAGAAATCTCGAGATTTCTTGGATAAGTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-831s21c1
Sequence:CCGGCCCAGTGATGGAACTATATTACTCGAGTAATATAGTTCCATCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-1305s21c1
Sequence:CCGGCCAGGTTGTCTCCTGGTTAAACTCGAGTTTAACCAGGAGACAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016205.1-1608s1c1
Sequence:CCGGCCATCCTTAATCTCAGTTGTTCTCGAGAACAACTGAGATTAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-681s1c1
Sequence:CCGGCCTCATACTTATCCAAGAAATCTCGAGATTTCTTGGATAAGTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016205.1-831s1c1
Sequence:CCGGCCCAGTGATGGAACTATATTACTCGAGTAATATAGTTCCATCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-621s1c1
Sequence:CCGGCCTCAGCATGAGAGAATTATTCTCGAGAATAATTCTCTCATGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-1305s1c1
Sequence:CCGGCCAGGTTGTCTCCTGGTTAAACTCGAGTTTAACCAGGAGACAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-621s21c1
Sequence:CCGGCCTCAGCATGAGAGAATTATTCTCGAGAATAATTCTCTCATGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016205
VALIDATED
PDGFC MISSION shRNA Lentiviral Transduction Particles
platelet derived growth factor C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-681s21c1
Sequence:CCGGCCTCATACTTATCCAAGAAATCTCGAGATTTCTTGGATAAGTATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-831s21c1
Sequence:CCGGCCCAGTGATGGAACTATATTACTCGAGTAATATAGTTCCATCACTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-1305s21c1
Sequence:CCGGCCAGGTTGTCTCCTGGTTAAACTCGAGTTTAACCAGGAGACAACCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016205.1-1608s1c1
Sequence:CCGGCCATCCTTAATCTCAGTTGTTCTCGAGAACAACTGAGATTAAGGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-681s1c1
Sequence:CCGGCCTCATACTTATCCAAGAAATCTCGAGATTTCTTGGATAAGTATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016205.1-831s1c1
Sequence:CCGGCCCAGTGATGGAACTATATTACTCGAGTAATATAGTTCCATCACTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-621s1c1
Sequence:CCGGCCTCAGCATGAGAGAATTATTCTCGAGAATAATTCTCTCATGCTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000118190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016205.1-1305s1c1
Sequence:CCGGCCAGGTTGTCTCCTGGTTAAACTCGAGTTTAACCAGGAGACAACCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016205.1-621s21c1
Sequence:CCGGCCTCAGCATGAGAGAATTATTCTCGAGAATAATTCTCTCATGCTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019971
VALIDATED
PDGFC MISSION shRNA Bacterial Glycerol Stock
platelet derived growth factor C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1312s21c1
Sequence:CCGGAGATCCAGAAGACGATATATGCTCGAGCATATATCGTCTTCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1872s21c1
Sequence:CCGGGTGCCTGTTGTCTCCATAATTCTCGAGAATTATGGAGACAACAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1901s21c1
Sequence:CCGGTGTCAGTGTGTCCCACGTAAACTCGAGTTTACGTGGGACACACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-2157s21c1
Sequence:CCGGGCTGATGCTGGCTATGGTAAACTCGAGTTTACCATAGCCAGCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1200s21c1
Sequence:CCGGGCCCGAAGTTTCCTCATACATCTCGAGATGTATGAGGAAACTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019971.2-1418s1c1
Sequence:CCGGCAGACTTCTAAAGGAAATCATCTCGAGATGATTTCCTTTAGAAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1166s1c1
Sequence:CCGGGTTGTCACTATATCTGGTAATCTCGAGATTACCAGATATAGTGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1200s1c1
Sequence:CCGGGCCCGAAGTTTCCTCATACATCTCGAGATGTATGAGGAAACTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019971.2-1282s1c1
Sequence:CCGGGCTGACATTTGATGAGAGATTCTCGAGAATCTCTCATCAAATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1872s1c1
Sequence:CCGGGTGCCTGTTGTCTCCATAATTCTCGAGAATTATGGAGACAACAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019971
VALIDATED
PDGFC MISSION shRNA shRNA Plasmid DNA
platelet derived growth factor C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1312s21c1
Sequence:CCGGAGATCCAGAAGACGATATATGCTCGAGCATATATCGTCTTCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1872s21c1
Sequence:CCGGGTGCCTGTTGTCTCCATAATTCTCGAGAATTATGGAGACAACAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1901s21c1
Sequence:CCGGTGTCAGTGTGTCCCACGTAAACTCGAGTTTACGTGGGACACACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-2157s21c1
Sequence:CCGGGCTGATGCTGGCTATGGTAAACTCGAGTTTACCATAGCCAGCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1200s21c1
Sequence:CCGGGCCCGAAGTTTCCTCATACATCTCGAGATGTATGAGGAAACTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019971.2-1418s1c1
Sequence:CCGGCAGACTTCTAAAGGAAATCATCTCGAGATGATTTCCTTTAGAAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1166s1c1
Sequence:CCGGGTTGTCACTATATCTGGTAATCTCGAGATTACCAGATATAGTGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1200s1c1
Sequence:CCGGGCCCGAAGTTTCCTCATACATCTCGAGATGTATGAGGAAACTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019971.2-1282s1c1
Sequence:CCGGGCTGACATTTGATGAGAGATTCTCGAGAATCTCTCATCAAATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1872s1c1
Sequence:CCGGGTGCCTGTTGTCTCCATAATTCTCGAGAATTATGGAGACAACAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019971
VALIDATED
PDGFC MISSION shRNA Lentiviral Transduction Particles
platelet derived growth factor C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1312s21c1
Sequence:CCGGAGATCCAGAAGACGATATATGCTCGAGCATATATCGTCTTCTGGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1872s21c1
Sequence:CCGGGTGCCTGTTGTCTCCATAATTCTCGAGAATTATGGAGACAACAGGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000314012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1901s21c1
Sequence:CCGGTGTCAGTGTGTCCCACGTAAACTCGAGTTTACGTGGGACACACTGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000313939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-2157s21c1
Sequence:CCGGGCTGATGCTGGCTATGGTAAACTCGAGTTTACCATAGCCAGCATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000317595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019971.2-1200s21c1
Sequence:CCGGGCCCGAAGTTTCCTCATACATCTCGAGATGTATGAGGAAACTTCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019971.2-1418s1c1
Sequence:CCGGCAGACTTCTAAAGGAAATCATCTCGAGATGATTTCCTTTAGAAGTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1166s1c1
Sequence:CCGGGTTGTCACTATATCTGGTAATCTCGAGATTACCAGATATAGTGACAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1200s1c1
Sequence:CCGGGCCCGAAGTTTCCTCATACATCTCGAGATGTATGAGGAAACTTCGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019971.2-1282s1c1
Sequence:CCGGGCTGACATTTGATGAGAGATTCTCGAGAATCTCTCATCAAATGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000065800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019971.2-1872s1c1
Sequence:CCGGGTGCCTGTTGTCTCCATAATTCTCGAGAATTATGGAGACAACAGGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???