EMAIL THIS PAGE TO A FRIEND

PDHA1

pyruvate dehydrogenase (lipoamide) alpha 1

62 Gene Product Result for
Synonyms: PDHA PDHCE1A PHE1A
Gene ID:
Human(5160) Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
Mouse(18597) pyruvate dehydrogenase E1 alpha 1
Rat(29554) pyruvate dehydrogenase (lipoamide) alpha 1
chicken(418610) pyruvate dehydrogenase (lipoamide) alpha 1
domestic cat(101080765) pyruvate dehydrogenase (lipoamide) alpha 1
dog(480858) pyruvate dehydrogenase (lipoamide) alpha 1
cow(407109) pyruvate dehydrogenase (lipoamide) alpha 1
sheep(101110118) pyruvate dehydrogenase (lipoamide) alpha 1
domestic guinea pig(100735725) pyruvate dehydrogenase (lipoamide) alpha 1
naked mole-rat(101716937) pyruvate dehydrogenase (lipoamide) alpha 1
Domestic Rabbit(100357349) pyruvate dehydrogenase (lipoamide) alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK183 PDH Activity Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000284 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000284 Rosetta Predictions human pricing
NM_001004072 Rosetta Predictions rat pricing
NM_008810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082458 predicted 731
2 SASI_Hs01_00082459 predicted 536
3 SASI_Hs02_00302242 predicted 1388
4 SASI_Hs01_00082461 predicted 1085
5 SASI_Hs01_00082462 predicted 1122
6 SASI_Hs01_00082463 predicted 822
7 SASI_Hs01_00082464 predicted 1079
8 SASI_Hs01_00082465 predicted 365
9 SASI_Hs01_00082466 predicted 999
10 SASI_Hs01_00082467 predicted 998
11 SASI_Hs01_00082460 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087296 predicted 664
2 SASI_Rn01_00087298 predicted 993
3 SASI_Rn02_00198094 predicted 1217
4 SASI_Rn01_00087299 predicted 976
5 SASI_Rn02_00198095 predicted 1178
6 SASI_Rn01_00087301 predicted 929
7 SASI_Rn01_00087302 predicted 676
8 SASI_Rn02_00198096 predicted 1250
9 SASI_Rn01_00087303 predicted 1016
10 SASI_Rn01_00087304 predicted 966
11 SASI_Rn01_00087297 predicted 628
12 SASI_Rn01_00087300 predicted 599
13 SASI_Rn01_00087305 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119978 predicted 624
2 SASI_Mm01_00119979 predicted 420
3 SASI_Mm01_00119980 predicted 608
4 SASI_Mm02_00314736 predicted 473
5 SASI_Mm02_00314737 predicted 544
6 SASI_Mm01_00119981 predicted 1133
7 SASI_Mm01_00119982 predicted 986
8 SASI_Mm01_00119983 predicted 628
9 SASI_Mm01_00119984 predicted 1188
10 SASI_Mm01_00119985 predicted 627
11 SASI_Mm01_00119986 predicted 1177
12 SASI_Mm01_00119987 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008810
PDHA1 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase (lipoamide) alpha 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-207s1c1
Sequence:CCGGGCTCAAGTACTACAGGATGATCTCGAGATCATCCTGTAGTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-834s1c1
Sequence:CCGGTGCCTATTGCAGGTCTGGTAACTCGAGTTACCAGACCTGCAATAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-630s1c1
Sequence:CCGGTCAGATCTTTGAAGCTTACAACTCGAGTTGTAAGCTTCAAAGATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-145s1c1
Sequence:CCGGTGTGACCTTCATCGGCTAGAACTCGAGTTCTAGCCGATGAAGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-630s21c1
Sequence:CCGGTCAGATCTTTGAAGCTTACAACTCGAGTTGTAAGCTTCAAAGATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-207s21c1
Sequence:CCGGGCTCAAGTACTACAGGATGATCTCGAGATCATCCTGTAGTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-834s21c1
Sequence:CCGGTGCCTATTGCAGGTCTGGTAACTCGAGTTACCAGACCTGCAATAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-145s21c1
Sequence:CCGGTGTGACCTTCATCGGCTAGAACTCGAGTTCTAGCCGATGAAGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008810
PDHA1 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase (lipoamide) alpha 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-207s1c1
Sequence:CCGGGCTCAAGTACTACAGGATGATCTCGAGATCATCCTGTAGTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-834s1c1
Sequence:CCGGTGCCTATTGCAGGTCTGGTAACTCGAGTTACCAGACCTGCAATAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-630s1c1
Sequence:CCGGTCAGATCTTTGAAGCTTACAACTCGAGTTGTAAGCTTCAAAGATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-145s1c1
Sequence:CCGGTGTGACCTTCATCGGCTAGAACTCGAGTTCTAGCCGATGAAGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-630s21c1
Sequence:CCGGTCAGATCTTTGAAGCTTACAACTCGAGTTGTAAGCTTCAAAGATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-207s21c1
Sequence:CCGGGCTCAAGTACTACAGGATGATCTCGAGATCATCCTGTAGTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-834s21c1
Sequence:CCGGTGCCTATTGCAGGTCTGGTAACTCGAGTTACCAGACCTGCAATAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-145s21c1
Sequence:CCGGTGTGACCTTCATCGGCTAGAACTCGAGTTCTAGCCGATGAAGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008810
PDHA1 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase (lipoamide) alpha 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-207s1c1
Sequence:CCGGGCTCAAGTACTACAGGATGATCTCGAGATCATCCTGTAGTACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-834s1c1
Sequence:CCGGTGCCTATTGCAGGTCTGGTAACTCGAGTTACCAGACCTGCAATAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-630s1c1
Sequence:CCGGTCAGATCTTTGAAGCTTACAACTCGAGTTGTAAGCTTCAAAGATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008810.2-145s1c1
Sequence:CCGGTGTGACCTTCATCGGCTAGAACTCGAGTTCTAGCCGATGAAGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-630s21c1
Sequence:CCGGTCAGATCTTTGAAGCTTACAACTCGAGTTGTAAGCTTCAAAGATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-207s21c1
Sequence:CCGGGCTCAAGTACTACAGGATGATCTCGAGATCATCCTGTAGTACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-834s21c1
Sequence:CCGGTGCCTATTGCAGGTCTGGTAACTCGAGTTACCAGACCTGCAATAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008810.2-145s21c1
Sequence:CCGGTGTGACCTTCATCGGCTAGAACTCGAGTTCTAGCCGATGAAGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000284
VALIDATED
PDHA1 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase (lipoamide) alpha 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-174s1c1
Sequence:CCGGGCTGGTAGCATCCCGTAATTTCTCGAGAAATTACGGGATGCTACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-1243s1c1
Sequence:CCGGGCCAATCAGTGGATCAAGTTTCTCGAGAAACTTGATCCACTGATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-322s1c1
Sequence:CCGGCGAATGGAGTTGAAAGCAGATCTCGAGATCTGCTTTCAACTCCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-770s1c1
Sequence:CCGGGTGAGAATAATCGCTATGGAACTCGAGTTCCATAGCGATTATTCTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000284.1-499s1c1
Sequence:CCGGCGAGAAATTCTCGCAGAGCTTCTCGAGAAGCTCTGCGAGAATTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-1283s21c1
Sequence:CCGGGCCAATCAGTGGATCAAGTTTCTCGAGAAACTTGATCCACTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-214s21c1
Sequence:CCGGGCTGGTAGCATCCCGTAATTTCTCGAGAAATTACGGGATGCTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-810s21c1
Sequence:CCGGGTGAGAATAATCGCTATGGAACTCGAGTTCCATAGCGATTATTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-362s21c1
Sequence:CCGGCGAATGGAGTTGAAAGCAGATCTCGAGATCTGCTTTCAACTCCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000284
VALIDATED
PDHA1 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase (lipoamide) alpha 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-174s1c1
Sequence:CCGGGCTGGTAGCATCCCGTAATTTCTCGAGAAATTACGGGATGCTACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-1243s1c1
Sequence:CCGGGCCAATCAGTGGATCAAGTTTCTCGAGAAACTTGATCCACTGATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-322s1c1
Sequence:CCGGCGAATGGAGTTGAAAGCAGATCTCGAGATCTGCTTTCAACTCCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-770s1c1
Sequence:CCGGGTGAGAATAATCGCTATGGAACTCGAGTTCCATAGCGATTATTCTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000284.1-499s1c1
Sequence:CCGGCGAGAAATTCTCGCAGAGCTTCTCGAGAAGCTCTGCGAGAATTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-1283s21c1
Sequence:CCGGGCCAATCAGTGGATCAAGTTTCTCGAGAAACTTGATCCACTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-214s21c1
Sequence:CCGGGCTGGTAGCATCCCGTAATTTCTCGAGAAATTACGGGATGCTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-810s21c1
Sequence:CCGGGTGAGAATAATCGCTATGGAACTCGAGTTCCATAGCGATTATTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-362s21c1
Sequence:CCGGCGAATGGAGTTGAAAGCAGATCTCGAGATCTGCTTTCAACTCCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000284
VALIDATED
PDHA1 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase (lipoamide) alpha 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-174s1c1
Sequence:CCGGGCTGGTAGCATCCCGTAATTTCTCGAGAAATTACGGGATGCTACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-1243s1c1
Sequence:CCGGGCCAATCAGTGGATCAAGTTTCTCGAGAAACTTGATCCACTGATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-322s1c1
Sequence:CCGGCGAATGGAGTTGAAAGCAGATCTCGAGATCTGCTTTCAACTCCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000284.1-770s1c1
Sequence:CCGGGTGAGAATAATCGCTATGGAACTCGAGTTCCATAGCGATTATTCTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000284.1-499s1c1
Sequence:CCGGCGAGAAATTCTCGCAGAGCTTCTCGAGAAGCTCTGCGAGAATTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-1283s21c1
Sequence:CCGGGCCAATCAGTGGATCAAGTTTCTCGAGAAACTTGATCCACTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-214s21c1
Sequence:CCGGGCTGGTAGCATCCCGTAATTTCTCGAGAAATTACGGGATGCTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-810s21c1
Sequence:CCGGGTGAGAATAATCGCTATGGAACTCGAGTTCCATAGCGATTATTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000284.2-362s21c1
Sequence:CCGGCGAATGGAGTTGAAAGCAGATCTCGAGATCTGCTTTCAACTCCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)