EMAIL THIS PAGE TO A FRIEND

PDHA2

pyruvate dehydrogenase (lipoamide) alpha 2

61 Gene Product Result for
Synonyms: PDHAL
UniProtKB ID: P29803, B2R9Q3, Q0VDI5, Q4VC02, Q6NXQ1
Gene ID:
Mouse(18598) pyruvate dehydrogenase E1 alpha 2
Rat(117098) pyruvate dehydrogenase (lipoamide) alpha 2
cow(768012) pyruvate dehydrogenase (lipoamide) alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK183 PDH Activity Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005390 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005390 Rosetta Predictions human pricing
NM_053994 Rosetta Predictions rat pricing
XM_579589 Rosetta Predictions rat pricing
NM_008811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071933 predicted 263
2 SASI_Hs01_00071934 predicted 914
3 SASI_Hs01_00071936 predicted 430
4 SASI_Hs01_00071938 predicted 801
5 SASI_Hs01_00071939 predicted 609
6 SASI_Hs01_00071940 predicted 656
7 SASI_Hs01_00071941 predicted 991
8 SASI_Hs02_00339515 predicted 397
9 SASI_Hs02_00339516 predicted 297
10 SASI_Hs02_00339517 predicted 712
11 SASI_Hs01_00071935 predicted 832
12 SASI_Hs01_00071937 predicted 609
13 SASI_Hs01_00071942 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041568 predicted 970
2 SASI_Rn01_00041569 predicted 359
3 SASI_Rn01_00041570 predicted 750
4 SASI_Rn01_00041571 predicted 717
5 SASI_Rn02_00266988 predicted 1132
6 SASI_Rn01_00041573 predicted 1044
7 SASI_Rn02_00266989 predicted 1082
8 SASI_Rn01_00041574 predicted 939
9 SASI_Rn01_00041575 predicted 1013
10 SASI_Rn02_00266990 predicted 1233
11 SASI_Rn01_00041567 predicted 1519
12 SASI_Rn01_00041572 predicted 1711
13 SASI_Rn01_00041576 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131043 predicted 417
2 SASI_Rn01_00131044 predicted 390
3 SASI_Rn01_00131045 predicted 249
4 SASI_Rn01_00131046 predicted 400
5 SASI_Rn01_00131047 predicted 281
6 SASI_Rn01_00131048 predicted 395
7 SASI_Rn01_00131049 predicted 267
8 SASI_Rn01_00131050 predicted 274
9 SASI_Rn01_00131051 predicted 314
10 SASI_Rn01_00131052 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178309 predicted 1467
2 SASI_Mm01_00178310 predicted 1580
3 SASI_Mm01_00178311 predicted 1302
4 SASI_Mm01_00178312 predicted 1024
5 SASI_Mm01_00178313 predicted 925
6 SASI_Mm01_00178314 predicted 1397
7 SASI_Mm01_00178315 predicted 1483
8 SASI_Mm01_00178316 predicted 716
9 SASI_Mm01_00178318 predicted 1568
10 SASI_Mm02_00314738 predicted 1547
11 SASI_Mm01_00178317 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005390
PDHA2 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase (lipoamide) alpha 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-392s21c1
Sequence:CCGGATCACGTCATTACATCCTATACTCGAGTATAGGATGTAATGACGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-719s21c1
Sequence:CCGGTCTGTGAGAATAACCTATATGCTCGAGCATATAGGTTATTCTCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-989s21c1
Sequence:CCGGGAAGTAAGAGGGATCCTATAACTCGAGTTATAGGATCCCTCTTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-665s21c1
Sequence:GTACCGGAGATAGCCGAAGCTTTCAATACTCGAGTATTGAAAGCTTCGGCTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-1196s21c1
Sequence:CCGGCAAATCCATGGATCAAGTTTACTCGAGTAAACTTGATCCATGGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-270s1c1
Sequence:CCGGCGCATGGAATTGAAGGCAGATCTCGAGATCTGCCTTCAATTCCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-382s1c1
Sequence:CCGGCCTCGGATCACGTCATTACATCTCGAGATGTAATGACGTGATCCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-1010s1c1
Sequence:CCGGTCTCCAAGATAGAATGGTAAACTCGAGTTTACCATTCTATCTTGGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-129s1c1
Sequence:CCGGGCATCCCGTAACTCCTCAAATCTCGAGATTTGAGGAGTTACGGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005390
PDHA2 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase (lipoamide) alpha 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-392s21c1
Sequence:CCGGATCACGTCATTACATCCTATACTCGAGTATAGGATGTAATGACGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-719s21c1
Sequence:CCGGTCTGTGAGAATAACCTATATGCTCGAGCATATAGGTTATTCTCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-989s21c1
Sequence:CCGGGAAGTAAGAGGGATCCTATAACTCGAGTTATAGGATCCCTCTTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-665s21c1
Sequence:GTACCGGAGATAGCCGAAGCTTTCAATACTCGAGTATTGAAAGCTTCGGCTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-1196s21c1
Sequence:CCGGCAAATCCATGGATCAAGTTTACTCGAGTAAACTTGATCCATGGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-270s1c1
Sequence:CCGGCGCATGGAATTGAAGGCAGATCTCGAGATCTGCCTTCAATTCCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-382s1c1
Sequence:CCGGCCTCGGATCACGTCATTACATCTCGAGATGTAATGACGTGATCCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-1010s1c1
Sequence:CCGGTCTCCAAGATAGAATGGTAAACTCGAGTTTACCATTCTATCTTGGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-129s1c1
Sequence:CCGGGCATCCCGTAACTCCTCAAATCTCGAGATTTGAGGAGTTACGGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005390
PDHA2 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase (lipoamide) alpha 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-392s21c1
Sequence:CCGGATCACGTCATTACATCCTATACTCGAGTATAGGATGTAATGACGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-719s21c1
Sequence:CCGGTCTGTGAGAATAACCTATATGCTCGAGCATATAGGTTATTCTCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-989s21c1
Sequence:CCGGGAAGTAAGAGGGATCCTATAACTCGAGTTATAGGATCCCTCTTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-665s21c1
Sequence:GTACCGGAGATAGCCGAAGCTTTCAATACTCGAGTATTGAAAGCTTCGGCTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005390.4-1196s21c1
Sequence:CCGGCAAATCCATGGATCAAGTTTACTCGAGTAAACTTGATCCATGGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-270s1c1
Sequence:CCGGCGCATGGAATTGAAGGCAGATCTCGAGATCTGCCTTCAATTCCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-382s1c1
Sequence:CCGGCCTCGGATCACGTCATTACATCTCGAGATGTAATGACGTGATCCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-1010s1c1
Sequence:CCGGTCTCCAAGATAGAATGGTAAACTCGAGTTTACCATTCTATCTTGGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005390.3-129s1c1
Sequence:CCGGGCATCCCGTAACTCCTCAAATCTCGAGATTTGAGGAGTTACGGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008811
PDHA2 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase (lipoamide) alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1471s1c1
Sequence:CCGGCCGTTATCATGGACACAGTATCTCGAGATACTGTGTCCATGATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-679s1c1
Sequence:CCGGACTGCTGTCATCTCTGAAGTTCTCGAGAACTTCAGAGATGACAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1216s1c1
Sequence:CCGGGCAGGTATTCGAAGCATACAACTCGAGTTGTATGCTTCGAATACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1688s1c1
Sequence:CCGGGCTGTGGAAGATATAGCCAATCTCGAGATTGGCTATATCTTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1762s1c1
Sequence:CCGGCAAGTATAAGTCCCACAGTTACTCGAGTAACTGTGGGACTTATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008811
PDHA2 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase (lipoamide) alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1471s1c1
Sequence:CCGGCCGTTATCATGGACACAGTATCTCGAGATACTGTGTCCATGATAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-679s1c1
Sequence:CCGGACTGCTGTCATCTCTGAAGTTCTCGAGAACTTCAGAGATGACAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1216s1c1
Sequence:CCGGGCAGGTATTCGAAGCATACAACTCGAGTTGTATGCTTCGAATACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1688s1c1
Sequence:CCGGGCTGTGGAAGATATAGCCAATCTCGAGATTGGCTATATCTTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1762s1c1
Sequence:CCGGCAAGTATAAGTCCCACAGTTACTCGAGTAACTGTGGGACTTATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008811
PDHA2 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase (lipoamide) alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1471s1c1
Sequence:CCGGCCGTTATCATGGACACAGTATCTCGAGATACTGTGTCCATGATAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-679s1c1
Sequence:CCGGACTGCTGTCATCTCTGAAGTTCTCGAGAACTTCAGAGATGACAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1216s1c1
Sequence:CCGGGCAGGTATTCGAAGCATACAACTCGAGTTGTATGCTTCGAATACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1688s1c1
Sequence:CCGGGCTGTGGAAGATATAGCCAATCTCGAGATTGGCTATATCTTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008811.1-1762s1c1
Sequence:CCGGCAAGTATAAGTCCCACAGTTACTCGAGTAACTGTGGGACTTATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)