EMAIL THIS PAGE TO A FRIEND

PDIA3

protein disulfide isomerase family A, member 3

108 Gene Product Result for
Synonyms: ER60 ERp57 ERp60 ERp61 GRP57 GRP58 HsT17083 P58 PI-PLC
UniProtKB ID: P30101, Q13453, Q14255, Q8IYF8, Q9UMU7
Gene ID:
Human(2923) Summary: This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. [provided by RefSeq, Jul 2008]
Mouse(14827) protein disulfide isomerase associated 3
Rat(29468) protein disulfide isomerase family A, member 3
naked mole-rat(101721675) protein disulfide isomerase family A, member 3
Domestic Rabbit(100328685) protein disulfide isomerase family A, member 3
domestic guinea pig(100725599) protein disulfide isomerase family A, member 3
cow(281803) protein disulfide isomerase family A, member 3
Goat(100860882) protein disulfide isomerase family A, member 3
sheep(100302346) protein disulfide isomerase family A, member 3
Zebrafish(378851) protein disulfide isomerase family A, member 3
chicken(373899) protein disulfide isomerase family A, member 3
domestic cat(101097245) protein disulfide isomerase family A, member 3
dog(478279) protein disulfide isomerase family A, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005313 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005313 Rosetta Predictions human pricing
NM_017319 Rosetta Predictions rat pricing
NM_007952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029128 predicted 729
2 SASI_Hs01_00029130 predicted 754
3 SASI_Hs01_00029131 predicted 682
4 SASI_Hs01_00029132 predicted 321
5 SASI_Hs02_00339377 predicted 776
6 SASI_Hs02_00339378 predicted 881
7 SASI_Hs02_00339379 predicted 583
8 SASI_Hs01_00029133 predicted 916
9 SASI_Hs01_00029135 predicted 931
10 SASI_Hs01_00029136 predicted 665
11 SASI_Hs01_00029129 predicted 964
12 SASI_Hs01_00029134 predicted 1245
13 SASI_Hs01_00029137 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091220 predicted 846
2 SASI_Rn01_00091221 predicted 498
3 SASI_Rn01_00091222 predicted 430
4 SASI_Rn01_00091223 predicted 1474
5 SASI_Rn01_00091224 predicted 1400
6 SASI_Rn01_00091225 predicted 396
7 SASI_Rn01_00091226 predicted 806
8 SASI_Rn01_00091227 predicted 501
9 SASI_Rn01_00091228 predicted 859
10 SASI_Rn01_00091229 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181387 predicted 903
2 SASI_Mm02_00312819 predicted 443
3 SASI_Mm01_00181388 predicted 752
4 SASI_Mm01_00181389 predicted 1401
5 SASI_Mm01_00181390 predicted 558
6 SASI_Mm01_00181392 predicted 742
7 SASI_Mm01_00181393 predicted 497
8 SASI_Mm01_00181394 predicted 1465
9 SASI_Mm01_00181395 predicted 950
10 SASI_Mm01_00181396 predicted 677
11 SASI_Mm01_00181391 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007952
PDIA3 MISSION shRNA Bacterial Glycerol Stock
protein disulfide isomerase family A, member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007952.2-1796s21c1
Sequence:CCGGGACCAGTTTATGTTTGTGGTTCTCGAGAACCACAAACATAAACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-1570s21c1
Sequence:CCGGGCTATCTACAACGAGAAGCTACTCGAGTAGCTTCTCGTTGTAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-923s21c1
Sequence:CCGGCGCTTACTATGATGTGGACTACTCGAGTAGTCCACATCATAGTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-396s21c1
Sequence:CCGGGCCAACACAAACACCTGTAATCTCGAGATTACAGGTGTTTGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007952.1-1735s1c1
Sequence:CCGGGACCAGTTTATGTTTGTGGTTCTCGAGAACCACAAACATAAACTGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-1509s1c1
Sequence:CCGGGCTATCTACAACGAGAAGCTACTCGAGTAGCTTCTCGTTGTAGATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-862s1c1
Sequence:CCGGCGCTTACTATGATGTGGACTACTCGAGTAGTCCACATCATAGTAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-335s1c1
Sequence:CCGGGCCAACACAAACACCTGTAATCTCGAGATTACAGGTGTTTGTGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-1135s1c1
Sequence:CCGGGCAGGAATACTTTGATGGCAACTCGAGTTGCCATCAAAGTATTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007952
PDIA3 MISSION shRNA shRNA Plasmid DNA
protein disulfide isomerase family A, member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007952.2-1796s21c1
Sequence:CCGGGACCAGTTTATGTTTGTGGTTCTCGAGAACCACAAACATAAACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-1570s21c1
Sequence:CCGGGCTATCTACAACGAGAAGCTACTCGAGTAGCTTCTCGTTGTAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-923s21c1
Sequence:CCGGCGCTTACTATGATGTGGACTACTCGAGTAGTCCACATCATAGTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-396s21c1
Sequence:CCGGGCCAACACAAACACCTGTAATCTCGAGATTACAGGTGTTTGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007952.1-1735s1c1
Sequence:CCGGGACCAGTTTATGTTTGTGGTTCTCGAGAACCACAAACATAAACTGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-1509s1c1
Sequence:CCGGGCTATCTACAACGAGAAGCTACTCGAGTAGCTTCTCGTTGTAGATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-862s1c1
Sequence:CCGGCGCTTACTATGATGTGGACTACTCGAGTAGTCCACATCATAGTAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-335s1c1
Sequence:CCGGGCCAACACAAACACCTGTAATCTCGAGATTACAGGTGTTTGTGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-1135s1c1
Sequence:CCGGGCAGGAATACTTTGATGGCAACTCGAGTTGCCATCAAAGTATTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007952
PDIA3 MISSION shRNA Lentiviral Transduction Particles
protein disulfide isomerase family A, member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007952.2-1796s21c1
Sequence:CCGGGACCAGTTTATGTTTGTGGTTCTCGAGAACCACAAACATAAACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-1570s21c1
Sequence:CCGGGCTATCTACAACGAGAAGCTACTCGAGTAGCTTCTCGTTGTAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-923s21c1
Sequence:CCGGCGCTTACTATGATGTGGACTACTCGAGTAGTCCACATCATAGTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007952.2-396s21c1
Sequence:CCGGGCCAACACAAACACCTGTAATCTCGAGATTACAGGTGTTTGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007952.1-1735s1c1
Sequence:CCGGGACCAGTTTATGTTTGTGGTTCTCGAGAACCACAAACATAAACTGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-1509s1c1
Sequence:CCGGGCTATCTACAACGAGAAGCTACTCGAGTAGCTTCTCGTTGTAGATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-862s1c1
Sequence:CCGGCGCTTACTATGATGTGGACTACTCGAGTAGTCCACATCATAGTAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-335s1c1
Sequence:CCGGGCCAACACAAACACCTGTAATCTCGAGATTACAGGTGTTTGTGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007952.1-1135s1c1
Sequence:CCGGGCAGGAATACTTTGATGGCAACTCGAGTTGCCATCAAAGTATTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005313
PDIA3 MISSION shRNA Bacterial Glycerol Stock
protein disulfide isomerase family A, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-408s21c1
Sequence:CCGGCCAACACTAACACCTGTAATACTCGAGTATTACAGGTGTTAGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005313.4-1828s21c1
Sequence:CCGGGCTGCACTGTTTATGGAAATACTCGAGTATTTCCATAAACAGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-935s21c1
Sequence:CCGGGCTTACTATGATGTGGACTATCTCGAGATAGTCCACATCATAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-695s21c1
Sequence:CCGGCGATTTGCACATACGAATGTTCTCGAGAACATTCGTATGTGCAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005313.3-1769s1c1
Sequence:CCGGGCTGCACTGTTTATGGAAATACTCGAGTATTTCCATAAACAGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-876s1c1
Sequence:CCGGGCTTACTATGATGTGGACTATCTCGAGATAGTCCACATCATAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-636s1c1
Sequence:CCGGCGATTTGCACATACGAATGTTCTCGAGAACATTCGTATGTGCAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-349s1c1
Sequence:CCGGCCAACACTAACACCTGTAATACTCGAGTATTACAGGTGTTAGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005313
PDIA3 MISSION shRNA shRNA Plasmid DNA
protein disulfide isomerase family A, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-408s21c1
Sequence:CCGGCCAACACTAACACCTGTAATACTCGAGTATTACAGGTGTTAGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005313.4-1828s21c1
Sequence:CCGGGCTGCACTGTTTATGGAAATACTCGAGTATTTCCATAAACAGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-935s21c1
Sequence:CCGGGCTTACTATGATGTGGACTATCTCGAGATAGTCCACATCATAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-695s21c1
Sequence:CCGGCGATTTGCACATACGAATGTTCTCGAGAACATTCGTATGTGCAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005313.3-1769s1c1
Sequence:CCGGGCTGCACTGTTTATGGAAATACTCGAGTATTTCCATAAACAGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-876s1c1
Sequence:CCGGGCTTACTATGATGTGGACTATCTCGAGATAGTCCACATCATAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-636s1c1
Sequence:CCGGCGATTTGCACATACGAATGTTCTCGAGAACATTCGTATGTGCAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-349s1c1
Sequence:CCGGCCAACACTAACACCTGTAATACTCGAGTATTACAGGTGTTAGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005313
PDIA3 MISSION shRNA Lentiviral Transduction Particles
protein disulfide isomerase family A, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-408s21c1
Sequence:CCGGCCAACACTAACACCTGTAATACTCGAGTATTACAGGTGTTAGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005313.4-1828s21c1
Sequence:CCGGGCTGCACTGTTTATGGAAATACTCGAGTATTTCCATAAACAGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-935s21c1
Sequence:CCGGGCTTACTATGATGTGGACTATCTCGAGATAGTCCACATCATAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005313.4-695s21c1
Sequence:CCGGCGATTTGCACATACGAATGTTCTCGAGAACATTCGTATGTGCAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005313.3-1769s1c1
Sequence:CCGGGCTGCACTGTTTATGGAAATACTCGAGTATTTCCATAAACAGTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-876s1c1
Sequence:CCGGGCTTACTATGATGTGGACTATCTCGAGATAGTCCACATCATAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-636s1c1
Sequence:CCGGCGATTTGCACATACGAATGTTCTCGAGAACATTCGTATGTGCAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005313.3-349s1c1
Sequence:CCGGCCAACACTAACACCTGTAATACTCGAGTATTACAGGTGTTAGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)