EMAIL THIS PAGE TO A FRIEND

PDIK1L

PDLIM1 interacting kinase 1 like

276 Gene Product Result for
Synonyms: CLIK1L STK35L2
UniProtKB ID: Q8N165, B2R777, D3DPK2, Q5T2I0, Q8NDB3
Gene ID:
Mouse(230809) PDLIM1 interacting kinase 1 like
Rat(313609) PDLIM1 interacting kinase 1 like
naked mole-rat(101706377) PDLIM1 interacting kinase 1 like
domestic guinea pig(100731472) PDLIM1 interacting kinase 1 like
cow(510253) PDLIM1 interacting kinase 1 like
sheep(101112887) PDLIM1 interacting kinase 1 like
Zebrafish(569665) PDLIM1 interacting kinase 1 like
domestic cat(101084212) PDLIM1 interacting kinase 1 like
dog(100684736) PDLIM1 interacting kinase 1 like
chicken(419604) PDLIM1 interacting kinase 1 like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152835 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152835 Rosetta Predictions human pricing
NM_001107984 Rosetta Predictions rat pricing
NM_146156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235296 predicted 1175
2 SASI_Hs01_00235297 predicted 775
3 SASI_Hs01_00235299 predicted 471
4 SASI_Hs01_00235300 predicted 1188
5 SASI_Hs01_00235301 predicted 333
6 SASI_Hs01_00235302 predicted 892
7 SASI_Hs01_00235304 predicted 1191
8 SASI_Hs01_00235305 predicted 439
9 SASI_Hs02_00366767 predicted 965
10 SASI_Hs02_00366768 predicted 914
11 SASI_Hs01_00235298 predicted 625
12 SASI_Hs01_00235303 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234215 predicted 623
2 SASI_Rn02_00234216 predicted 414
3 SASI_Rn02_00234217 predicted 237
4 SASI_Rn02_00234218 predicted 343
5 SASI_Rn02_00234219 predicted 1059
6 SASI_Rn02_00234220 predicted 242
7 SASI_Rn02_00234221 predicted 693
8 SASI_Rn02_00234222 predicted 336
9 SASI_Rn02_00234223 predicted 1063
10 SASI_Rn02_00234224 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023679 predicted 763
2 SASI_Mm01_00023680 predicted 477
3 SASI_Mm01_00023681 predicted 1200
4 SASI_Mm01_00023682 predicted 381
5 SASI_Mm01_00023683 predicted 481
6 SASI_Mm01_00023684 predicted 370
7 SASI_Mm01_00023685 predicted 1130
8 SASI_Mm01_00023686 predicted 264
9 SASI_Mm01_00023687 predicted 1035
10 SASI_Mm01_00023688 predicted 1321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146156
VALIDATED
PDIK1L MISSION shRNA Bacterial Glycerol Stock
PDLIM1 interacting kinase 1 like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-1199s21c1
Sequence:CCGGGAACTCAGATTAGTCCAAATTCTCGAGAATTTGGACTAATCTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-1128s21c1
Sequence:CCGGGGCGAATGAAACAACTGATAACTCGAGTTATCAGTTGTTTCATTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146156.2-544s21c1
Sequence:CCGGTGATCCCAGAAGCGCCTATTACTCGAGTAATAGGCGCTTCTGGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146156.2-1570s21c1
Sequence:CCGGCCTTGTCAGTATTAGGCATTTCTCGAGAAATGCCTAATACTGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-788s21c1
Sequence:CCGGGCTGATTTCGGCCTAAGTAAACTCGAGTTTACTTAGGCCGAAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-774s1c1
Sequence:CCGGCCACACTCAAAGTGGCTGATTCTCGAGAATCAGCCACTTTGAGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-416s1c1
Sequence:CCGGCCAAATGTGATTCACTTGGAACTCGAGTTCCAAGTGAATCACATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146156.2-1199s1c1
Sequence:CCGGGAACTCAGATTAGTCCAAATTCTCGAGAATTTGGACTAATCTGAGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146156.2-1129s1c1
Sequence:CCGGGCGAATGAAACAACTGATAAACTCGAGTTTATCAGTTGTTTCATTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-592s1c1
Sequence:CCGGCGGAGGAGATATGAATGAGTACTCGAGTACTCATTCATATCTCCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146156
VALIDATED
PDIK1L MISSION shRNA shRNA Plasmid DNA
PDLIM1 interacting kinase 1 like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-1199s21c1
Sequence:CCGGGAACTCAGATTAGTCCAAATTCTCGAGAATTTGGACTAATCTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-1128s21c1
Sequence:CCGGGGCGAATGAAACAACTGATAACTCGAGTTATCAGTTGTTTCATTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146156.2-544s21c1
Sequence:CCGGTGATCCCAGAAGCGCCTATTACTCGAGTAATAGGCGCTTCTGGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146156.2-1570s21c1
Sequence:CCGGCCTTGTCAGTATTAGGCATTTCTCGAGAAATGCCTAATACTGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-788s21c1
Sequence:CCGGGCTGATTTCGGCCTAAGTAAACTCGAGTTTACTTAGGCCGAAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-774s1c1
Sequence:CCGGCCACACTCAAAGTGGCTGATTCTCGAGAATCAGCCACTTTGAGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-416s1c1
Sequence:CCGGCCAAATGTGATTCACTTGGAACTCGAGTTCCAAGTGAATCACATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146156.2-1199s1c1
Sequence:CCGGGAACTCAGATTAGTCCAAATTCTCGAGAATTTGGACTAATCTGAGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146156.2-1129s1c1
Sequence:CCGGGCGAATGAAACAACTGATAAACTCGAGTTTATCAGTTGTTTCATTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-592s1c1
Sequence:CCGGCGGAGGAGATATGAATGAGTACTCGAGTACTCATTCATATCTCCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146156
VALIDATED
PDIK1L MISSION shRNA Lentiviral Transduction Particles
PDLIM1 interacting kinase 1 like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-1199s21c1
Sequence:CCGGGAACTCAGATTAGTCCAAATTCTCGAGAATTTGGACTAATCTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-1128s21c1
Sequence:CCGGGGCGAATGAAACAACTGATAACTCGAGTTATCAGTTGTTTCATTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146156.2-544s21c1
Sequence:CCGGTGATCCCAGAAGCGCCTATTACTCGAGTAATAGGCGCTTCTGGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146156.2-1570s21c1
Sequence:CCGGCCTTGTCAGTATTAGGCATTTCTCGAGAAATGCCTAATACTGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146156.2-788s21c1
Sequence:CCGGGCTGATTTCGGCCTAAGTAAACTCGAGTTTACTTAGGCCGAAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-774s1c1
Sequence:CCGGCCACACTCAAAGTGGCTGATTCTCGAGAATCAGCCACTTTGAGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-416s1c1
Sequence:CCGGCCAAATGTGATTCACTTGGAACTCGAGTTCCAAGTGAATCACATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146156.2-1199s1c1
Sequence:CCGGGAACTCAGATTAGTCCAAATTCTCGAGAATTTGGACTAATCTGAGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146156.2-1129s1c1
Sequence:CCGGGCGAATGAAACAACTGATAAACTCGAGTTTATCAGTTGTTTCATTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146156.2-592s1c1
Sequence:CCGGCGGAGGAGATATGAATGAGTACTCGAGTACTCATTCATATCTCCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152835
VALIDATED
PDIK1L MISSION shRNA Bacterial Glycerol Stock
PDLIM1 interacting kinase 1 like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-458s1c1
Sequence:CCGGCTAAGCAGTATCAAGAGCCAACTCGAGTTGGCTCTTGATACTGCTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-622s1c1
Sequence:CCGGCGCCTATTATTTGTGGTTTGTCTCGAGACAAACCACAAATAATAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-545s1c1
Sequence:CCGGCACGGCTCTAATTCTTCCCTTCTCGAGAAGGGAAGAATTAGAGCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.x-3307s1c1
Sequence:CCGGCCACAGTTTCCTAAGCGCATACTCGAGTATGCGCTTAGGAAACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152835.x-1192s1c1
Sequence:CCGGTGGGCGAATGAAACAACTGATCTCGAGATCAGTTGTTTCATTCGCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.1-334s1c1
Sequence:CCGGCCGAGGTAGTTACGGTGTTGTCTCGAGACAACACCGTAACTACCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.1-3559s1c1
Sequence:CCGGGCACTAAAGGTTTGTTGATAACTCGAGTTATCAACAAACCTTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.1-2555s1c1
Sequence:CCGGCAATCACTGATACAGTCTATGCTCGAGCATAGACTGTATCAGTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.1-937s1c1
Sequence:CCGGCACAGCATGTGGAACAGATTTCTCGAGAAATCTGTTCCACATGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152835.1-902s1c1
Sequence:CCGGGAAGAACCTGTCAGTGTAAACCTCGAGGTTTACACTGACAGGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152835.1-1259s1c1
Sequence:CCGGGAACTAGAACTCAGATTAGTACTCGAGTACTAATCTGAGTTCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152835
VALIDATED
PDIK1L MISSION shRNA shRNA Plasmid DNA
PDLIM1 interacting kinase 1 like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-458s1c1
Sequence:CCGGCTAAGCAGTATCAAGAGCCAACTCGAGTTGGCTCTTGATACTGCTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-622s1c1
Sequence:CCGGCGCCTATTATTTGTGGTTTGTCTCGAGACAAACCACAAATAATAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-545s1c1
Sequence:CCGGCACGGCTCTAATTCTTCCCTTCTCGAGAAGGGAAGAATTAGAGCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.x-3307s1c1
Sequence:CCGGCCACAGTTTCCTAAGCGCATACTCGAGTATGCGCTTAGGAAACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152835.x-1192s1c1
Sequence:CCGGTGGGCGAATGAAACAACTGATCTCGAGATCAGTTGTTTCATTCGCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.1-334s1c1
Sequence:CCGGCCGAGGTAGTTACGGTGTTGTCTCGAGACAACACCGTAACTACCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.1-3559s1c1
Sequence:CCGGGCACTAAAGGTTTGTTGATAACTCGAGTTATCAACAAACCTTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.1-2555s1c1
Sequence:CCGGCAATCACTGATACAGTCTATGCTCGAGCATAGACTGTATCAGTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.1-937s1c1
Sequence:CCGGCACAGCATGTGGAACAGATTTCTCGAGAAATCTGTTCCACATGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152835.1-902s1c1
Sequence:CCGGGAAGAACCTGTCAGTGTAAACCTCGAGGTTTACACTGACAGGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152835.1-1259s1c1
Sequence:CCGGGAACTAGAACTCAGATTAGTACTCGAGTACTAATCTGAGTTCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152835
VALIDATED
PDIK1L MISSION shRNA Lentiviral Transduction Particles
PDLIM1 interacting kinase 1 like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-458s1c1
Sequence:CCGGCTAAGCAGTATCAAGAGCCAACTCGAGTTGGCTCTTGATACTGCTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-622s1c1
Sequence:CCGGCGCCTATTATTTGTGGTTTGTCTCGAGACAAACCACAAATAATAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.x-545s1c1
Sequence:CCGGCACGGCTCTAATTCTTCCCTTCTCGAGAAGGGAAGAATTAGAGCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.x-3307s1c1
Sequence:CCGGCCACAGTTTCCTAAGCGCATACTCGAGTATGCGCTTAGGAAACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152835.x-1192s1c1
Sequence:CCGGTGGGCGAATGAAACAACTGATCTCGAGATCAGTTGTTTCATTCGCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.1-334s1c1
Sequence:CCGGCCGAGGTAGTTACGGTGTTGTCTCGAGACAACACCGTAACTACCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.1-3559s1c1
Sequence:CCGGGCACTAAAGGTTTGTTGATAACTCGAGTTATCAACAAACCTTTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152835.1-2555s1c1
Sequence:CCGGCAATCACTGATACAGTCTATGCTCGAGCATAGACTGTATCAGTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152835.1-937s1c1
Sequence:CCGGCACAGCATGTGGAACAGATTTCTCGAGAAATCTGTTCCACATGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152835.1-902s1c1
Sequence:CCGGGAAGAACCTGTCAGTGTAAACCTCGAGGTTTACACTGACAGGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152835.1-1259s1c1
Sequence:CCGGGAACTAGAACTCAGATTAGTACTCGAGTACTAATCTGAGTTCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)