EMAIL THIS PAGE TO A FRIEND

PDK2

pyruvate dehydrogenase kinase, isozyme 2

66 Gene Product Result for
Synonyms: PDHK2 PDKII
UniProtKB ID: Q15119, A8K3A7, B3KNW0, Q6P515, Q9BS05
Gene ID:
Human(5164) Summary: This gene encodes a member of the pyruvate dehydrogenase kinase family. The encoded protein phosphorylates pyruvate dehydrogenase, down-regulating the activity of the mitochondrial pyruvate dehydrogenase complex. Overexpression of this gene may play a role in both cancer and diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(18604) pyruvate dehydrogenase kinase, isoenzyme 2
Rat(81530) pyruvate dehydrogenase kinase, isozyme 2
domestic guinea pig(100734517) pyruvate dehydrogenase kinase, isozyme 2
naked mole-rat(101699994) pyruvate dehydrogenase kinase, isozyme 2
cow(524075) pyruvate dehydrogenase kinase, isozyme 2
sheep(101108929) pyruvate dehydrogenase kinase, isozyme 2
Zebrafish(393971) pyruvate dehydrogenase kinase, isoenzyme 2
dog(491075) pyruvate dehydrogenase kinase, isozyme 2
domestic cat(101100013) pyruvate dehydrogenase kinase, isozyme 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002611 Rosetta Predictions human pricing
NM_030872 Rosetta Predictions rat pricing
NM_133667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246811 predicted 687
2 SASI_Hs02_00334123 predicted 1000
3 SASI_Hs01_00246812 predicted 720
4 SASI_Hs01_00246813 predicted 637
5 SASI_Hs01_00246815 predicted 1302
6 SASI_Hs01_00246816 predicted 1450
7 SASI_Hs01_00246817 predicted 771
8 SASI_Hs01_00246818 predicted 1113
9 SASI_Hs01_00246819 predicted 695
10 SASI_Hs01_00246820 predicted 1287
11 SASI_Hs01_00246814 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033227 predicted 565
2 SASI_Rn02_00264136 predicted 651
3 SASI_Rn01_00033229 predicted 511
4 SASI_Rn01_00033230 predicted 716
5 SASI_Rn01_00033231 predicted 199
6 SASI_Rn02_00264137 predicted 1488
7 SASI_Rn01_00033232 predicted 936
8 SASI_Rn01_00033233 predicted 1497
9 SASI_Rn01_00033234 predicted 1591
10 SASI_Rn01_00033235 predicted 1697
11 SASI_Rn01_00033228 predicted 1437
12 SASI_Rn01_00033236 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023197 predicted 536
2 SASI_Mm01_00023198 predicted 207
3 SASI_Mm01_00023199 predicted 1464
4 SASI_Mm01_00023200 predicted 1698
5 SASI_Mm01_00023201 predicted 1439
6 SASI_Mm01_00023202 predicted 1132
7 SASI_Mm01_00023203 predicted 689
8 SASI_Mm01_00023204 predicted 774
9 SASI_Mm01_00023205 predicted 909
10 SASI_Mm01_00023206 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133667
VALIDATED
PDK2 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase kinase, isozyme 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-1268s1c1
Sequence:CCGGCCCAAGAACACATCGACGTATCTCGAGATACGTCGATGTGTTCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-479s1c1
Sequence:CCGGCTGGAGTACAAGGACACCTATCTCGAGATAGGTGTCCTTGTACTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-706s1c1
Sequence:CCGGCCTGTGTGACAAGTATTACATCTCGAGATGTAATACTTGTCACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-211s1c1
Sequence:CCGGCGAGAAGACGTCATTCACTTTCTCGAGAAAGTGAATGACGTCTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-745s21c1
Sequence:CCGGCCTGTGTGACAAGTATTACATCTCGAGATGTAATACTTGTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-601s21c1
Sequence:CCGGCATCTCCATCCGAATGCTAATCTCGAGATTAGCATTCGGATGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-250s21c1
Sequence:CCGGCGAGAAGACGTCATTCACTTTCTCGAGAAAGTGAATGACGTCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-1307s21c1
Sequence:CCGGCCCAAGAACACATCGACGTATCTCGAGATACGTCGATGTGTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-1395s21c1
Sequence:CCGGCAGGGACCTTCCCTATCTATCCTCGAGGATAGATAGGGAAGGTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133667
VALIDATED
PDK2 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase kinase, isozyme 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-1268s1c1
Sequence:CCGGCCCAAGAACACATCGACGTATCTCGAGATACGTCGATGTGTTCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-479s1c1
Sequence:CCGGCTGGAGTACAAGGACACCTATCTCGAGATAGGTGTCCTTGTACTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-706s1c1
Sequence:CCGGCCTGTGTGACAAGTATTACATCTCGAGATGTAATACTTGTCACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-211s1c1
Sequence:CCGGCGAGAAGACGTCATTCACTTTCTCGAGAAAGTGAATGACGTCTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-745s21c1
Sequence:CCGGCCTGTGTGACAAGTATTACATCTCGAGATGTAATACTTGTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-601s21c1
Sequence:CCGGCATCTCCATCCGAATGCTAATCTCGAGATTAGCATTCGGATGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-250s21c1
Sequence:CCGGCGAGAAGACGTCATTCACTTTCTCGAGAAAGTGAATGACGTCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-1307s21c1
Sequence:CCGGCCCAAGAACACATCGACGTATCTCGAGATACGTCGATGTGTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-1395s21c1
Sequence:CCGGCAGGGACCTTCCCTATCTATCCTCGAGGATAGATAGGGAAGGTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133667
VALIDATED
PDK2 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase kinase, isozyme 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-1268s1c1
Sequence:CCGGCCCAAGAACACATCGACGTATCTCGAGATACGTCGATGTGTTCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-479s1c1
Sequence:CCGGCTGGAGTACAAGGACACCTATCTCGAGATAGGTGTCCTTGTACTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-706s1c1
Sequence:CCGGCCTGTGTGACAAGTATTACATCTCGAGATGTAATACTTGTCACACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133667.1-211s1c1
Sequence:CCGGCGAGAAGACGTCATTCACTTTCTCGAGAAAGTGAATGACGTCTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-745s21c1
Sequence:CCGGCCTGTGTGACAAGTATTACATCTCGAGATGTAATACTTGTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-601s21c1
Sequence:CCGGCATCTCCATCCGAATGCTAATCTCGAGATTAGCATTCGGATGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-250s21c1
Sequence:CCGGCGAGAAGACGTCATTCACTTTCTCGAGAAAGTGAATGACGTCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-1307s21c1
Sequence:CCGGCCCAAGAACACATCGACGTATCTCGAGATACGTCGATGTGTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133667.2-1395s21c1
Sequence:CCGGCAGGGACCTTCCCTATCTATCCTCGAGGATAGATAGGGAAGGTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002611
VALIDATED
PDK2 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase kinase, isozyme 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-834s1c1
Sequence:CCGGCACCTCTACCACATGCTCTTTCTCGAGAAAGAGCATGTGGTAGAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-803s1c1
Sequence:CCGGACAGCCGATTCACATGGTCTACTCGAGTAGACCATGTGAATCGGCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-778s1c1
Sequence:CCGGAGGAGATCAATGCAGCCAACTCTCGAGAGTTGGCTGCATTGATCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-1929s1c1
Sequence:CCGGACCTTGTTAGACCGAGAGCTTCTCGAGAAGCTCTCGGTCTAACAAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-158s1c1
Sequence:CCGGGTACATAGAGCACTTCAGCAACTCGAGTTGCTGAAGTGCTCTATGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002611.3-1334s1c1
Sequence:CCGGGCCGTGCATCTGCACCTGAGACTCGAGTCTCAGGTGCAGATGCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-544s1c1
Sequence:CCGGCCAACCAGAACATCCAGTACTCTCGAGAGTACTGGATGTTCTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-731s1c1
Sequence:CCGGGCTCCTGTGTGACAAGTATTACTCGAGTAATACTTGTCACACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-995s1c1
Sequence:CCGGGAGGAAGATTGAGCGACTCTTCTCGAGAAGAGTCGCTCAATCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002611
VALIDATED
PDK2 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase kinase, isozyme 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-834s1c1
Sequence:CCGGCACCTCTACCACATGCTCTTTCTCGAGAAAGAGCATGTGGTAGAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-803s1c1
Sequence:CCGGACAGCCGATTCACATGGTCTACTCGAGTAGACCATGTGAATCGGCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-778s1c1
Sequence:CCGGAGGAGATCAATGCAGCCAACTCTCGAGAGTTGGCTGCATTGATCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-1929s1c1
Sequence:CCGGACCTTGTTAGACCGAGAGCTTCTCGAGAAGCTCTCGGTCTAACAAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-158s1c1
Sequence:CCGGGTACATAGAGCACTTCAGCAACTCGAGTTGCTGAAGTGCTCTATGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002611.3-1334s1c1
Sequence:CCGGGCCGTGCATCTGCACCTGAGACTCGAGTCTCAGGTGCAGATGCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-544s1c1
Sequence:CCGGCCAACCAGAACATCCAGTACTCTCGAGAGTACTGGATGTTCTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-731s1c1
Sequence:CCGGGCTCCTGTGTGACAAGTATTACTCGAGTAATACTTGTCACACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-995s1c1
Sequence:CCGGGAGGAAGATTGAGCGACTCTTCTCGAGAAGAGTCGCTCAATCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002611
VALIDATED
PDK2 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase kinase, isozyme 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-834s1c1
Sequence:CCGGCACCTCTACCACATGCTCTTTCTCGAGAAAGAGCATGTGGTAGAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-803s1c1
Sequence:CCGGACAGCCGATTCACATGGTCTACTCGAGTAGACCATGTGAATCGGCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-778s1c1
Sequence:CCGGAGGAGATCAATGCAGCCAACTCTCGAGAGTTGGCTGCATTGATCTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-1929s1c1
Sequence:CCGGACCTTGTTAGACCGAGAGCTTCTCGAGAAGCTCTCGGTCTAACAAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002611.x-158s1c1
Sequence:CCGGGTACATAGAGCACTTCAGCAACTCGAGTTGCTGAAGTGCTCTATGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002611.3-1334s1c1
Sequence:CCGGGCCGTGCATCTGCACCTGAGACTCGAGTCTCAGGTGCAGATGCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-544s1c1
Sequence:CCGGCCAACCAGAACATCCAGTACTCTCGAGAGTACTGGATGTTCTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-731s1c1
Sequence:CCGGGCTCCTGTGTGACAAGTATTACTCGAGTAATACTTGTCACACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002611.3-995s1c1
Sequence:CCGGGAGGAAGATTGAGCGACTCTTCTCGAGAAGAGTCGCTCAATCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)