EMAIL THIS PAGE TO A FRIEND

PDK3

pyruvate dehydrogenase kinase, isozyme 3

73 Gene Product Result for
UniProtKB ID: Q15120, B4DXG6
Gene ID:
Human(5165) Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(236900) pyruvate dehydrogenase kinase, isoenzyme 3
Rat(296849) pyruvate dehydrogenase kinase, isozyme 3
chicken(418595) pyruvate dehydrogenase kinase, isozyme 3
domestic cat(101095314) pyruvate dehydrogenase kinase, isozyme 3
Horse(100060791) pyruvate dehydrogenase kinase, isozyme 3
dog(480868) pyruvate dehydrogenase kinase, isozyme 3
cow(510841) pyruvate dehydrogenase kinase, isozyme 3
sheep(101108725) pyruvate dehydrogenase kinase, isozyme 3
naked mole-rat(101699582) pyruvate dehydrogenase kinase, isozyme 3
domestic guinea pig(100725367) pyruvate dehydrogenase kinase, isozyme 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005391 Rosetta Predictions human pricing
NM_001106581 Rosetta Predictions rat pricing
NM_145630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152329 predicted 861
2 SASI_Hs01_00152331 predicted 493
3 SASI_Hs01_00152332 predicted 840
4 SASI_Hs01_00152333 predicted 704
5 SASI_Hs01_00152334 predicted 849
6 SASI_Hs01_00152335 predicted 342
7 SASI_Hs01_00152336 predicted 574
8 SASI_Hs01_00152337 predicted 848
9 SASI_Hs01_00152338 predicted 580
10 SASI_Hs02_00339518 predicted 551
11 SASI_Hs01_00152330 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220358 predicted 608
2 SASI_Rn02_00220359 predicted 1481
3 SASI_Rn02_00220360 predicted 865
4 SASI_Rn02_00220361 predicted 908
5 SASI_Rn02_00220362 predicted 1494
6 SASI_Rn02_00220363 predicted 1514
7 SASI_Rn02_00220364 predicted 410
8 SASI_Rn02_00220365 predicted 873
9 SASI_Rn02_00220366 predicted 1000
10 SASI_Rn02_00220367 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094592 predicted 271
2 SASI_Mm01_00094593 predicted 721
3 SASI_Mm01_00094595 predicted 835
4 SASI_Mm01_00094596 predicted 1448
5 SASI_Mm01_00094597 predicted 1322
6 SASI_Mm01_00094598 predicted 710
7 SASI_Mm01_00094599 predicted 637
8 SASI_Mm01_00094601 predicted 888
9 SASI_Mm02_00341213 predicted 1126
10 SASI_Mm02_00341214 predicted 869
11 SASI_Mm01_00094594 predicted 964
12 SASI_Mm01_00094600 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005391
VALIDATED
PDK3 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase kinase, isozyme 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-1220s21c1
Sequence:GTACCGGTCCCGTCTGTATGCTAGATATCTCGAGATATCTAGCATACAGACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005391.3-536s21c1
Sequence:CCGGCAGGTCTTGGATAACTTTCTACTCGAGTAGAAAGTTATCCAAGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.1-549s1c1
Sequence:CCGGCTAATCCTGTTCATCCTAAACCTCGAGGTTTAGGATGAACAGGATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005391.1-563s1c1
Sequence:CCGGCCTAAACACATAGGAAGTATCCTCGAGGATACTTCCTATGTGTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1354s1c1
Sequence:CCGGGATTTGGCCTGCCATCAATTTCTCGAGAAATTGATGGCAGGCCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-421s21c1
Sequence:CCGGTAATCTTCTGCCGGATAATTTCTCGAGAAATTATCCGGCAGAAGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005391.3-647s21c1
Sequence:CCGGGATCCTTTCATTAGCACTAACCTCGAGGTTAGTGCTAATGAAAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1322s1c1
Sequence:CCGGGCAGTGTAGAGGTATTCACAACTCGAGTTGTGAATACCTCTACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005391.3-1455s21c1
Sequence:CCGGCCACCTTGATTTCCATTACAACTCGAGTTGTAATGGAAATCAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.x-1393s1c1
Sequence:CCGGGTTTGCAGTTTGTCCTCATAACTCGAGTTATGAGGACAAACTGCAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.x-264s1c1
Sequence:CCGGAGAGTTGGTATATGCAGAGTTCTCGAGAACTCTGCATATACCAACTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.x-190s1c1
Sequence:CCGGGCTGGCTAACACAATGAGAGACTCGAGTCTCTCATTGTGTTAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-471s21c1
Sequence:CCGGAGAGTTGGTATATGCAGAGTTCTCGAGAACTCTGCATATACCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1406s1c1
Sequence:CCGGCCTCATAAACGTTGTAGGTTGCTCGAGCAACCTACAACGTTTATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005391.1-440s1c1
Sequence:CCGGGATCCTTTCATTAGCACTAACCTCGAGGTTAGTGCTAATGAAAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005391
VALIDATED
PDK3 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase kinase, isozyme 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-1220s21c1
Sequence:GTACCGGTCCCGTCTGTATGCTAGATATCTCGAGATATCTAGCATACAGACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005391.3-536s21c1
Sequence:CCGGCAGGTCTTGGATAACTTTCTACTCGAGTAGAAAGTTATCCAAGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.1-549s1c1
Sequence:CCGGCTAATCCTGTTCATCCTAAACCTCGAGGTTTAGGATGAACAGGATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005391.1-563s1c1
Sequence:CCGGCCTAAACACATAGGAAGTATCCTCGAGGATACTTCCTATGTGTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1354s1c1
Sequence:CCGGGATTTGGCCTGCCATCAATTTCTCGAGAAATTGATGGCAGGCCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-421s21c1
Sequence:CCGGTAATCTTCTGCCGGATAATTTCTCGAGAAATTATCCGGCAGAAGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005391.3-647s21c1
Sequence:CCGGGATCCTTTCATTAGCACTAACCTCGAGGTTAGTGCTAATGAAAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1322s1c1
Sequence:CCGGGCAGTGTAGAGGTATTCACAACTCGAGTTGTGAATACCTCTACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005391.3-1455s21c1
Sequence:CCGGCCACCTTGATTTCCATTACAACTCGAGTTGTAATGGAAATCAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.x-1393s1c1
Sequence:CCGGGTTTGCAGTTTGTCCTCATAACTCGAGTTATGAGGACAAACTGCAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.x-264s1c1
Sequence:CCGGAGAGTTGGTATATGCAGAGTTCTCGAGAACTCTGCATATACCAACTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.x-190s1c1
Sequence:CCGGGCTGGCTAACACAATGAGAGACTCGAGTCTCTCATTGTGTTAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-471s21c1
Sequence:CCGGAGAGTTGGTATATGCAGAGTTCTCGAGAACTCTGCATATACCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1406s1c1
Sequence:CCGGCCTCATAAACGTTGTAGGTTGCTCGAGCAACCTACAACGTTTATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005391.1-440s1c1
Sequence:CCGGGATCCTTTCATTAGCACTAACCTCGAGGTTAGTGCTAATGAAAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005391
VALIDATED
PDK3 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase kinase, isozyme 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-1220s21c1
Sequence:GTACCGGTCCCGTCTGTATGCTAGATATCTCGAGATATCTAGCATACAGACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005391.3-536s21c1
Sequence:CCGGCAGGTCTTGGATAACTTTCTACTCGAGTAGAAAGTTATCCAAGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.1-549s1c1
Sequence:CCGGCTAATCCTGTTCATCCTAAACCTCGAGGTTTAGGATGAACAGGATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005391.1-563s1c1
Sequence:CCGGCCTAAACACATAGGAAGTATCCTCGAGGATACTTCCTATGTGTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1354s1c1
Sequence:CCGGGATTTGGCCTGCCATCAATTTCTCGAGAAATTGATGGCAGGCCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-421s21c1
Sequence:CCGGTAATCTTCTGCCGGATAATTTCTCGAGAAATTATCCGGCAGAAGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005391.3-647s21c1
Sequence:CCGGGATCCTTTCATTAGCACTAACCTCGAGGTTAGTGCTAATGAAAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1322s1c1
Sequence:CCGGGCAGTGTAGAGGTATTCACAACTCGAGTTGTGAATACCTCTACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314586    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005391.3-1455s21c1
Sequence:CCGGCCACCTTGATTTCCATTACAACTCGAGTTGTAATGGAAATCAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.x-1393s1c1
Sequence:CCGGGTTTGCAGTTTGTCCTCATAACTCGAGTTATGAGGACAAACTGCAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.x-264s1c1
Sequence:CCGGAGAGTTGGTATATGCAGAGTTCTCGAGAACTCTGCATATACCAACTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005391.x-190s1c1
Sequence:CCGGGCTGGCTAACACAATGAGAGACTCGAGTCTCTCATTGTGTTAGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005391.3-471s21c1
Sequence:CCGGAGAGTTGGTATATGCAGAGTTCTCGAGAACTCTGCATATACCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005391.1-1406s1c1
Sequence:CCGGCCTCATAAACGTTGTAGGTTGCTCGAGCAACCTACAACGTTTATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005391.1-440s1c1
Sequence:CCGGGATCCTTTCATTAGCACTAACCTCGAGGTTAGTGCTAATGAAAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145630
VALIDATED
PDK3 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase kinase, isozyme 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-529s21c1
Sequence:CCGGGCGTGATTGAGTACAAGGAAACTCGAGTTTCCTTGTACTCAATCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-906s21c1
Sequence:CCGGGCAACAGTTGAACTACATGAACTCGAGTTCATGTAGTTCAACTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-1656s21c1
Sequence:CCGGAGCGCTCTTGTACCCTATATTCTCGAGAATATAGGGTACAAGAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-1135s21c1
Sequence:CCGGCTCGTCTGTATGCCAGATATTCTCGAGAATATCTGGCATACAGACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-906s1c1
Sequence:CCGGGCAACAGTTGAACTACATGAACTCGAGTTCATGTAGTTCAACTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-529s1c1
Sequence:CCGGGCGTGATTGAGTACAAGGAAACTCGAGTTTCCTTGTACTCAATCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-1135s1c1
Sequence:CCGGCTCGTCTGTATGCCAGATATTCTCGAGAATATCTGGCATACAGACGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-674s1c1
Sequence:CCGGCCCTGCACATCCGAAACATATCTCGAGATATGTTTCGGATGTGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-708s1c1
Sequence:CCGGCCCACCTGTAATGTAGCTGATCTCGAGATCAGCTACATTACAGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145630
VALIDATED
PDK3 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase kinase, isozyme 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-529s21c1
Sequence:CCGGGCGTGATTGAGTACAAGGAAACTCGAGTTTCCTTGTACTCAATCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-906s21c1
Sequence:CCGGGCAACAGTTGAACTACATGAACTCGAGTTCATGTAGTTCAACTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-1656s21c1
Sequence:CCGGAGCGCTCTTGTACCCTATATTCTCGAGAATATAGGGTACAAGAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-1135s21c1
Sequence:CCGGCTCGTCTGTATGCCAGATATTCTCGAGAATATCTGGCATACAGACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-906s1c1
Sequence:CCGGGCAACAGTTGAACTACATGAACTCGAGTTCATGTAGTTCAACTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-529s1c1
Sequence:CCGGGCGTGATTGAGTACAAGGAAACTCGAGTTTCCTTGTACTCAATCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-1135s1c1
Sequence:CCGGCTCGTCTGTATGCCAGATATTCTCGAGAATATCTGGCATACAGACGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-674s1c1
Sequence:CCGGCCCTGCACATCCGAAACATATCTCGAGATATGTTTCGGATGTGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-708s1c1
Sequence:CCGGCCCACCTGTAATGTAGCTGATCTCGAGATCAGCTACATTACAGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145630
VALIDATED
PDK3 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase kinase, isozyme 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-529s21c1
Sequence:CCGGGCGTGATTGAGTACAAGGAAACTCGAGTTTCCTTGTACTCAATCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-906s21c1
Sequence:CCGGGCAACAGTTGAACTACATGAACTCGAGTTCATGTAGTTCAACTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-1656s21c1
Sequence:CCGGAGCGCTCTTGTACCCTATATTCTCGAGAATATAGGGTACAAGAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145630.2-1135s21c1
Sequence:CCGGCTCGTCTGTATGCCAGATATTCTCGAGAATATCTGGCATACAGACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-906s1c1
Sequence:CCGGGCAACAGTTGAACTACATGAACTCGAGTTCATGTAGTTCAACTGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-529s1c1
Sequence:CCGGGCGTGATTGAGTACAAGGAAACTCGAGTTTCCTTGTACTCAATCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-1135s1c1
Sequence:CCGGCTCGTCTGTATGCCAGATATTCTCGAGAATATCTGGCATACAGACGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-674s1c1
Sequence:CCGGCCCTGCACATCCGAAACATATCTCGAGATATGTTTCGGATGTGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145630.1-708s1c1
Sequence:CCGGCCCACCTGTAATGTAGCTGATCTCGAGATCAGCTACATTACAGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)