EMAIL THIS PAGE TO A FRIEND

PDK4

pyruvate dehydrogenase kinase, isozyme 4

66 Gene Product Result for
UniProtKB ID: Q16654
Gene ID:
Human(5166) Summary: This gene is a member of the PDK/BCKDK protein kinase family and encodes a mitochondrial protein with a histidine kinase domain. This protein is located in the matrix of the mitrochondria and inhibits the pyruvate dehydrogenase complex by phosphorylating one of its subunits, thereby contributing to the regulation of glucose metabolism. Expression of this gene is regulated by glucocorticoids, retinoic acid and insulin. [provided by RefSeq, Jul 2008]
Mouse(27273) pyruvate dehydrogenase kinase, isoenzyme 4
Rat(89813) pyruvate dehydrogenase kinase, isozyme 4
Zebrafish(561007) pyruvate dehydrogenase kinase, isozyme 4
chicken(420570) pyruvate dehydrogenase kinase, isozyme 4
domestic cat(101092256) pyruvate dehydrogenase kinase, isozyme 4
Horse(100052078) pyruvate dehydrogenase kinase, isozyme 4
dog(482310) pyruvate dehydrogenase kinase, isozyme 4
domestic guinea pig(100735301) pyruvate dehydrogenase kinase, isozyme 4
naked mole-rat(101698433) pyruvate dehydrogenase kinase, isozyme 4
Domestic Rabbit(100351580) pyruvate dehydrogenase kinase, isozyme 4
cow(507367) pyruvate dehydrogenase kinase, isozyme 4
sheep(101117752) pyruvate dehydrogenase kinase, isozyme 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002612 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002612 Rosetta Predictions human pricing
NM_053551 Rosetta Predictions rat pricing
NM_013743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334124 predicted 732
2 SASI_Hs01_00177897 predicted 1171
3 SASI_Hs01_00177898 predicted 1328
4 SASI_Hs01_00177900 predicted 1030
5 SASI_Hs02_00334125 predicted 1367
6 SASI_Hs01_00177901 predicted 833
7 SASI_Hs01_00177902 predicted 532
8 SASI_Hs01_00177903 predicted 695
9 SASI_Hs01_00177904 predicted 889
10 SASI_Hs01_00177905 predicted 1459
11 SASI_Hs01_00177899 predicted 651
12 SASI_Hs01_00177906 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048995 predicted 758
2 SASI_Rn01_00048996 predicted 469
3 SASI_Rn01_00048997 predicted 419
4 SASI_Rn01_00048999 predicted 273
5 SASI_Rn01_00049000 predicted 952
6 SASI_Rn01_00049001 predicted 768
7 SASI_Rn01_00049002 predicted 815
8 SASI_Rn01_00049003 predicted 828
9 SASI_Rn02_00266204 predicted 999
10 SASI_Rn02_00266205 predicted 1017
11 SASI_Rn01_00048994 predicted 635
12 SASI_Rn01_00048998 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053022 predicted 767
2 SASI_Mm01_00053023 predicted 965
3 SASI_Mm01_00053024 predicted 1317
4 SASI_Mm01_00053025 predicted 700
5 SASI_Mm01_00053026 predicted 476
6 SASI_Mm01_00053027 predicted 1011
7 SASI_Mm01_00053029 predicted 837
8 SASI_Mm01_00053030 predicted 1169
9 SASI_Mm02_00322687 predicted 827
10 SASI_Mm01_00053031 predicted 492
11 SASI_Mm01_00053028 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013743
VALIDATED
PDK4 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase kinase, isozyme 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-783s1c1
Sequence:CCGGCCAGAATTAAACCTCACACAACTCGAGTTGTGTGAGGTTTAATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-647s1c1
Sequence:CCGGCCTCATATTCAGTGACTCAAACTCGAGTTTGAGTCACTGAATATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-1028s1c1
Sequence:CCGGCCGCCTCTTTAGTTACACGTACTCGAGTACGTGTAACTAAAGAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-760s1c1
Sequence:CCGGGCGACCAGTATTATCTAACATCTCGAGATGTTAGATAATACTGGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-258s1c1
Sequence:CCGGGCCTGTGAAAGAACGTCCTTTCTCGAGAAAGGACGTTCTTTCACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013743.2-1399s21c1
Sequence:CCGGGGCATTGCTGCTTCGTGAATGCTCGAGCATTCACGAAGCAGCAATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-1165s21c1
Sequence:CCGGTCTACTCTATGTCAGGTTATGCTCGAGCATAACCTGACATAGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013743.2-751s21c1
Sequence:CCGGAGATGCTCTGCGACCAGTATTCTCGAGAATACTGGTCGCAGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013743.2-1190s21c1
Sequence:CCGGAGACGCTATCATCTACTTAAACTCGAGTTTAAGTAGATGATAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-483s21c1
Sequence:CCGGGTTCGAAACAGACATCATAATCTCGAGATTATGATGTCTGTTTCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-522s21c1
Sequence:CCGGCAAGGCATCCTGGAGTATAAACTCGAGTTTATACTCCAGGATGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013743.2-1802s21c1
Sequence:CCGGTGTACATTGTATAGGTATTAGCTCGAGCTAATACCTATACAATGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-773s21c1
Sequence:CCGGTCTAACATCGCCAGAATTAAACTCGAGTTTAATTCTGGCGATGTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013743
VALIDATED
PDK4 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase kinase, isozyme 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-783s1c1
Sequence:CCGGCCAGAATTAAACCTCACACAACTCGAGTTGTGTGAGGTTTAATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-647s1c1
Sequence:CCGGCCTCATATTCAGTGACTCAAACTCGAGTTTGAGTCACTGAATATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-1028s1c1
Sequence:CCGGCCGCCTCTTTAGTTACACGTACTCGAGTACGTGTAACTAAAGAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-760s1c1
Sequence:CCGGGCGACCAGTATTATCTAACATCTCGAGATGTTAGATAATACTGGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-258s1c1
Sequence:CCGGGCCTGTGAAAGAACGTCCTTTCTCGAGAAAGGACGTTCTTTCACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013743.2-1399s21c1
Sequence:CCGGGGCATTGCTGCTTCGTGAATGCTCGAGCATTCACGAAGCAGCAATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-1165s21c1
Sequence:CCGGTCTACTCTATGTCAGGTTATGCTCGAGCATAACCTGACATAGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013743.2-751s21c1
Sequence:CCGGAGATGCTCTGCGACCAGTATTCTCGAGAATACTGGTCGCAGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013743.2-1190s21c1
Sequence:CCGGAGACGCTATCATCTACTTAAACTCGAGTTTAAGTAGATGATAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-483s21c1
Sequence:CCGGGTTCGAAACAGACATCATAATCTCGAGATTATGATGTCTGTTTCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-522s21c1
Sequence:CCGGCAAGGCATCCTGGAGTATAAACTCGAGTTTATACTCCAGGATGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013743.2-1802s21c1
Sequence:CCGGTGTACATTGTATAGGTATTAGCTCGAGCTAATACCTATACAATGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-773s21c1
Sequence:CCGGTCTAACATCGCCAGAATTAAACTCGAGTTTAATTCTGGCGATGTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013743
VALIDATED
PDK4 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase kinase, isozyme 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-783s1c1
Sequence:CCGGCCAGAATTAAACCTCACACAACTCGAGTTGTGTGAGGTTTAATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-647s1c1
Sequence:CCGGCCTCATATTCAGTGACTCAAACTCGAGTTTGAGTCACTGAATATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-1028s1c1
Sequence:CCGGCCGCCTCTTTAGTTACACGTACTCGAGTACGTGTAACTAAAGAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-760s1c1
Sequence:CCGGGCGACCAGTATTATCTAACATCTCGAGATGTTAGATAATACTGGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013743.1-258s1c1
Sequence:CCGGGCCTGTGAAAGAACGTCCTTTCTCGAGAAAGGACGTTCTTTCACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013743.2-1399s21c1
Sequence:CCGGGGCATTGCTGCTTCGTGAATGCTCGAGCATTCACGAAGCAGCAATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-1165s21c1
Sequence:CCGGTCTACTCTATGTCAGGTTATGCTCGAGCATAACCTGACATAGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013743.2-751s21c1
Sequence:CCGGAGATGCTCTGCGACCAGTATTCTCGAGAATACTGGTCGCAGAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013743.2-1190s21c1
Sequence:CCGGAGACGCTATCATCTACTTAAACTCGAGTTTAAGTAGATGATAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-483s21c1
Sequence:CCGGGTTCGAAACAGACATCATAATCTCGAGATTATGATGTCTGTTTCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-522s21c1
Sequence:CCGGCAAGGCATCCTGGAGTATAAACTCGAGTTTATACTCCAGGATGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013743.2-1802s21c1
Sequence:CCGGTGTACATTGTATAGGTATTAGCTCGAGCTAATACCTATACAATGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013743.2-773s21c1
Sequence:CCGGTCTAACATCGCCAGAATTAAACTCGAGTTTAATTCTGGCGATGTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002612
VALIDATED
PDK4 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehydrogenase kinase, isozyme 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.3-687s1c1
Sequence:CCGGGTTCGAAATAGACACCATAATCTCGAGATTATGGTGTCTATTTCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-2954s1c1
Sequence:CCGGCCCGTGTCAATTAACATTTAACTCGAGTTAAATGTTAATTGACACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-762s1c1
Sequence:CCGGCCAAGCCACATTGGAAGCATTCTCGAGAATGCTTCCAATGTGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-908s1c1
Sequence:CCGGCCAACCAATTCACATCGTGTACTCGAGTACACGATGTGAATTGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-430s1c1
Sequence:CCGGCCCAATTAGTAAATACCTCTTCTCGAGAAGAGGTATTTACTAATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1112s1c1
Sequence:CCGGCCGCCTCTTTAGTTATACATACTCGAGTATGTATAACTAAAGAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.3-955s1c1
Sequence:CCGGGGATGCTCTGTGATCAGTATTCTCGAGAATACTGATCACAGAGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1297s1c1
Sequence:CCGGCTTTGTCTTCTGAGTCTATAGCTCGAGCTATAGACTCAGAAGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-1248s1c1
Sequence:CCGGCTCTACTCTTTATCAGGATATCTCGAGATATCCTGATAAAGAGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1614s1c1
Sequence:CCGGGTGCAAGACTACAGGAGTTAACTCGAGTTAACTCCTGTAGTCTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002612
VALIDATED
PDK4 MISSION shRNA shRNA Plasmid DNA
pyruvate dehydrogenase kinase, isozyme 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.3-687s1c1
Sequence:CCGGGTTCGAAATAGACACCATAATCTCGAGATTATGGTGTCTATTTCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-2954s1c1
Sequence:CCGGCCCGTGTCAATTAACATTTAACTCGAGTTAAATGTTAATTGACACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-762s1c1
Sequence:CCGGCCAAGCCACATTGGAAGCATTCTCGAGAATGCTTCCAATGTGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-908s1c1
Sequence:CCGGCCAACCAATTCACATCGTGTACTCGAGTACACGATGTGAATTGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-430s1c1
Sequence:CCGGCCCAATTAGTAAATACCTCTTCTCGAGAAGAGGTATTTACTAATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1112s1c1
Sequence:CCGGCCGCCTCTTTAGTTATACATACTCGAGTATGTATAACTAAAGAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.3-955s1c1
Sequence:CCGGGGATGCTCTGTGATCAGTATTCTCGAGAATACTGATCACAGAGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1297s1c1
Sequence:CCGGCTTTGTCTTCTGAGTCTATAGCTCGAGCTATAGACTCAGAAGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-1248s1c1
Sequence:CCGGCTCTACTCTTTATCAGGATATCTCGAGATATCCTGATAAAGAGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1614s1c1
Sequence:CCGGGTGCAAGACTACAGGAGTTAACTCGAGTTAACTCCTGTAGTCTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002612
VALIDATED
PDK4 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehydrogenase kinase, isozyme 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.3-687s1c1
Sequence:CCGGGTTCGAAATAGACACCATAATCTCGAGATTATGGTGTCTATTTCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-2954s1c1
Sequence:CCGGCCCGTGTCAATTAACATTTAACTCGAGTTAAATGTTAATTGACACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-762s1c1
Sequence:CCGGCCAAGCCACATTGGAAGCATTCTCGAGAATGCTTCCAATGTGGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-908s1c1
Sequence:CCGGCCAACCAATTCACATCGTGTACTCGAGTACACGATGTGAATTGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-430s1c1
Sequence:CCGGCCCAATTAGTAAATACCTCTTCTCGAGAAGAGGTATTTACTAATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1112s1c1
Sequence:CCGGCCGCCTCTTTAGTTATACATACTCGAGTATGTATAACTAAAGAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.3-955s1c1
Sequence:CCGGGGATGCTCTGTGATCAGTATTCTCGAGAATACTGATCACAGAGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1297s1c1
Sequence:CCGGCTTTGTCTTCTGAGTCTATAGCTCGAGCTATAGACTCAGAAGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002612.2-1248s1c1
Sequence:CCGGCTCTACTCTTTATCAGGATATCTCGAGATATCCTGATAAAGAGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002612.2-1614s1c1
Sequence:CCGGGTGCAAGACTACAGGAGTTAACTCGAGTTAACTCCTGTAGTCTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)