EMAIL THIS PAGE TO A FRIEND

PDLIM2

PDZ and LIM domain 2 (mystique)

133 Gene Product Result for
Synonyms: MYSTIQUE SLIM
Gene ID:
Human(64236) Summary: This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(213019) PDZ and LIM domain 2
Rat(290354) PDZ and LIM domain 2
Zebrafish(560322) PDZ and LIM domain 2 (mystique)
domestic cat(101087474) PDZ and LIM domain 2 (mystique)
dog(486123) PDZ and LIM domain 2 (mystique)
domestic guinea pig(100728017) PDZ and LIM domain 2 (mystique)
naked mole-rat(101721824) PDZ and LIM domain 2 (mystique)
cow(512907) PDZ and LIM domain 2 (mystique)
sheep(101114752) PDZ and LIM domain 2 (mystique)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021630 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094751 MISSION® esiRNA esiRNA human PDLIM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021630 Rosetta Predictions human pricing
NM_176871 Rosetta Predictions human pricing
NM_198042 Rosetta Predictions human pricing
NM_001007622 Rosetta Predictions rat pricing
NM_145978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202227 predicted 808
2 SASI_Hs01_00202228 predicted 728
3 SASI_Hs01_00202229 predicted 643
4 SASI_Hs01_00202230 predicted 713
5 SASI_Hs01_00202231 predicted 736
6 SASI_Hs01_00202232 predicted 840
7 SASI_Hs01_00202233 predicted 701
8 SASI_Hs01_00202234 predicted 629
9 SASI_Hs01_00202235 predicted 827
10 SASI_Hs01_00202236 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093308 predicted 550
2 SASI_Hs01_00093309 predicted 464
3 SASI_Hs01_00093310 predicted 377
4 SASI_Hs01_00093311 predicted 449
5 SASI_Hs01_00093312 predicted 465
6 SASI_Hs01_00093313 predicted 580
7 SASI_Hs01_00093314 predicted 435
8 SASI_Hs01_00093315 predicted 371
9 SASI_Hs01_00093316 predicted 563
10 SASI_Hs01_00093317 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243423 predicted 546
2 SASI_Hs01_00243424 predicted 463
3 SASI_Hs01_00243425 predicted 376
4 SASI_Hs01_00243426 predicted 455
5 SASI_Hs01_00243427 predicted 467
6 SASI_Hs01_00243428 predicted 573
7 SASI_Hs01_00243429 predicted 432
8 SASI_Hs01_00243430 predicted 371
9 SASI_Hs01_00243431 predicted 567
10 SASI_Hs01_00243432 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080510 predicted 592
2 SASI_Rn01_00080511 predicted 1092
3 SASI_Rn01_00080512 predicted 973
4 SASI_Rn01_00080513 predicted 1045
5 SASI_Rn01_00080514 predicted 962
6 SASI_Rn01_00080515 predicted 370
7 SASI_Rn02_00198710 predicted 1088
8 SASI_Rn01_00080516 predicted 1080
9 SASI_Rn01_00080517 predicted 761
10 SASI_Rn01_00080518 predicted 545
11 SASI_Rn01_00080509 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134760 predicted 201
2 SASI_Mm01_00134762 predicted 1037
3 SASI_Mm01_00134763 predicted 920
4 SASI_Mm01_00134764 predicted 1184
5 SASI_Mm01_00134765 predicted 1094
6 SASI_Mm02_00341478 predicted 317
7 SASI_Mm01_00134766 predicted 906
8 SASI_Mm01_00134767 predicted 1019
9 SASI_Mm01_00134768 predicted 516
10 SASI_Mm02_00341479 predicted 991
11 SASI_Mm01_00134761 predicted 1156
12 SASI_Mm01_00134769 predicted 501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145978
VALIDATED
PDLIM2 MISSION shRNA Bacterial Glycerol Stock
PDZ and LIM domain 2 (mystique)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145978.1-1362s1c1
Sequence:CCGGGCTGCCATGTTTGACACGAAACTCGAGTTTCGTGTCAAACATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-912s1c1
Sequence:CCGGCTGTGAGAAATGCAGCGTCAACTCGAGTTGACGCTGCATTTCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145978.1-682s1c1
Sequence:CCGGCCTAGGTTCAGCAGTTTGGATCTCGAGATCCAAACTGCTGAACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-130s1c1
Sequence:CCGGGATTTCCACACACCCATCATTCTCGAGAATGATGGGTGTGTGGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-501s1c1
Sequence:CCGGTGCCCTTTCTAAAGAGGATATCTCGAGATATCCTCTTTAGAAAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-1046s21c1
Sequence:CCGGATGAGTTGTACTGCGAGAAGCCTCGAGGCTTCTCGCAGTACAACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-682s21c1
Sequence:CCGGCCTAGGTTCAGCAGTTTGGATCTCGAGATCCAAACTGCTGAACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-912s21c1
Sequence:CCGGCTGTGAGAAATGCAGCGTCAACTCGAGTTGACGCTGCATTTCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-358s21c1
Sequence:CCGGGAAGTGCTGGCAACCAGATTCCTCGAGGAATCTGGTTGCCAGCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145978.1-1362s21c1
Sequence:CCGGGCTGCCATGTTTGACACGAAACTCGAGTTTCGTGTCAAACATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145978
VALIDATED
PDLIM2 MISSION shRNA shRNA Plasmid DNA
PDZ and LIM domain 2 (mystique)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145978.1-1362s1c1
Sequence:CCGGGCTGCCATGTTTGACACGAAACTCGAGTTTCGTGTCAAACATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-912s1c1
Sequence:CCGGCTGTGAGAAATGCAGCGTCAACTCGAGTTGACGCTGCATTTCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145978.1-682s1c1
Sequence:CCGGCCTAGGTTCAGCAGTTTGGATCTCGAGATCCAAACTGCTGAACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-130s1c1
Sequence:CCGGGATTTCCACACACCCATCATTCTCGAGAATGATGGGTGTGTGGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-501s1c1
Sequence:CCGGTGCCCTTTCTAAAGAGGATATCTCGAGATATCCTCTTTAGAAAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-1046s21c1
Sequence:CCGGATGAGTTGTACTGCGAGAAGCCTCGAGGCTTCTCGCAGTACAACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-682s21c1
Sequence:CCGGCCTAGGTTCAGCAGTTTGGATCTCGAGATCCAAACTGCTGAACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-912s21c1
Sequence:CCGGCTGTGAGAAATGCAGCGTCAACTCGAGTTGACGCTGCATTTCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-358s21c1
Sequence:CCGGGAAGTGCTGGCAACCAGATTCCTCGAGGAATCTGGTTGCCAGCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145978.1-1362s21c1
Sequence:CCGGGCTGCCATGTTTGACACGAAACTCGAGTTTCGTGTCAAACATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145978
VALIDATED
PDLIM2 MISSION shRNA Lentiviral Transduction Particles
PDZ and LIM domain 2 (mystique)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145978.1-1362s1c1
Sequence:CCGGGCTGCCATGTTTGACACGAAACTCGAGTTTCGTGTCAAACATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-912s1c1
Sequence:CCGGCTGTGAGAAATGCAGCGTCAACTCGAGTTGACGCTGCATTTCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145978.1-682s1c1
Sequence:CCGGCCTAGGTTCAGCAGTTTGGATCTCGAGATCCAAACTGCTGAACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-130s1c1
Sequence:CCGGGATTTCCACACACCCATCATTCTCGAGAATGATGGGTGTGTGGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145978.1-501s1c1
Sequence:CCGGTGCCCTTTCTAAAGAGGATATCTCGAGATATCCTCTTTAGAAAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-1046s21c1
Sequence:CCGGATGAGTTGTACTGCGAGAAGCCTCGAGGCTTCTCGCAGTACAACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-682s21c1
Sequence:CCGGCCTAGGTTCAGCAGTTTGGATCTCGAGATCCAAACTGCTGAACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-912s21c1
Sequence:CCGGCTGTGAGAAATGCAGCGTCAACTCGAGTTGACGCTGCATTTCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145978.1-358s21c1
Sequence:CCGGGAAGTGCTGGCAACCAGATTCCTCGAGGAATCTGGTTGCCAGCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145978.1-1362s21c1
Sequence:CCGGGCTGCCATGTTTGACACGAAACTCGAGTTTCGTGTCAAACATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021630
PDLIM2 MISSION shRNA Bacterial Glycerol Stock
PDZ and LIM domain 2 (mystique)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-1057s1c1
Sequence:CCGGCTCGGAAGTCTTCAAGATGCTCTCGAGAGCATCTTGAAGACTTCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021630.4-1243s1c1
Sequence:CCGGCAAGCTCCACACTTGTGAGAACTCGAGTTCTCACAAGTGTGGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021630.4-1696s1c1
Sequence:CCGGCCACTGCCTTTGATCAACCTTCTCGAGAAGGTTGATCAAAGGCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-1391s1c1
Sequence:CCGGGAGCTGTACTGTGAGAAGCATCTCGAGATGCTTCTCACAGTACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021630.4-1545s1c1
Sequence:CCGGGCTCTTACATGAGCTAAGTTTCTCGAGAAACTTAGCTCATGTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021630.4-1064s1c1
Sequence:CCGGGTCTTCAAGATGCTGCAGGAACTCGAGTTCCTGCAGCATCTTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-724s1c1
Sequence:CCGGGAGGACATACACTGAGAGTCACTCGAGTGACTCTCAGTGTATGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-861s21c1
Sequence:CCGGGCTTCCAGAGTCTGGCATGTTCTCGAGAACATGCCAGACTCTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-1253s21c1
Sequence:CCGGACTTGTGAGAAGTGCAGTACCCTCGAGGGTACTGCACTTCTCACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-538s21c1
Sequence:CCGGAGACATAATCGTGGCCATCAACTCGAGTTGATGGCCACGATTATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021630
PDLIM2 MISSION shRNA shRNA Plasmid DNA
PDZ and LIM domain 2 (mystique)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-1057s1c1
Sequence:CCGGCTCGGAAGTCTTCAAGATGCTCTCGAGAGCATCTTGAAGACTTCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021630.4-1243s1c1
Sequence:CCGGCAAGCTCCACACTTGTGAGAACTCGAGTTCTCACAAGTGTGGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021630.4-1696s1c1
Sequence:CCGGCCACTGCCTTTGATCAACCTTCTCGAGAAGGTTGATCAAAGGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-1391s1c1
Sequence:CCGGGAGCTGTACTGTGAGAAGCATCTCGAGATGCTTCTCACAGTACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021630.4-1545s1c1
Sequence:CCGGGCTCTTACATGAGCTAAGTTTCTCGAGAAACTTAGCTCATGTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021630.4-1064s1c1
Sequence:CCGGGTCTTCAAGATGCTGCAGGAACTCGAGTTCCTGCAGCATCTTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-724s1c1
Sequence:CCGGGAGGACATACACTGAGAGTCACTCGAGTGACTCTCAGTGTATGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-861s21c1
Sequence:CCGGGCTTCCAGAGTCTGGCATGTTCTCGAGAACATGCCAGACTCTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-1253s21c1
Sequence:CCGGACTTGTGAGAAGTGCAGTACCCTCGAGGGTACTGCACTTCTCACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-538s21c1
Sequence:CCGGAGACATAATCGTGGCCATCAACTCGAGTTGATGGCCACGATTATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021630
PDLIM2 MISSION shRNA Lentiviral Transduction Particles
PDZ and LIM domain 2 (mystique)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-1057s1c1
Sequence:CCGGCTCGGAAGTCTTCAAGATGCTCTCGAGAGCATCTTGAAGACTTCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021630.4-1243s1c1
Sequence:CCGGCAAGCTCCACACTTGTGAGAACTCGAGTTCTCACAAGTGTGGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021630.4-1696s1c1
Sequence:CCGGCCACTGCCTTTGATCAACCTTCTCGAGAAGGTTGATCAAAGGCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-1391s1c1
Sequence:CCGGGAGCTGTACTGTGAGAAGCATCTCGAGATGCTTCTCACAGTACAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021630.4-1545s1c1
Sequence:CCGGGCTCTTACATGAGCTAAGTTTCTCGAGAAACTTAGCTCATGTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021630.4-1064s1c1
Sequence:CCGGGTCTTCAAGATGCTGCAGGAACTCGAGTTCCTGCAGCATCTTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021630.4-724s1c1
Sequence:CCGGGAGGACATACACTGAGAGTCACTCGAGTGACTCTCAGTGTATGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-861s21c1
Sequence:CCGGGCTTCCAGAGTCTGGCATGTTCTCGAGAACATGCCAGACTCTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-1253s21c1
Sequence:CCGGACTTGTGAGAAGTGCAGTACCCTCGAGGGTACTGCACTTCTCACAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021630.4-538s21c1
Sequence:CCGGAGACATAATCGTGGCCATCAACTCGAGTTGATGGCCACGATTATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)