EMAIL THIS PAGE TO A FRIEND

PDLIM7

PDZ and LIM domain 7 (enigma)

113 Gene Product Result for
Synonyms: LMP1 LMP3
Gene ID:
Human(9260) Summary: The protein encoded by this gene is representative of a family of proteins composed of conserved PDZ and LIM domains. LIM domains are proposed to function in protein-protein recognition in a variety of contexts including gene transcription and development and in cytoskeletal interaction. The LIM domains of this protein bind to protein kinases, whereas the PDZ domain binds to actin filaments. The gene product is involved in the assembly of an actin filament-associated complex essential for transmission of ret/ptc2 mitogenic signaling. The biological function is likely to be that of an adapter, with the PDZ domain localizing the LIM-binding proteins to actin filaments of both skeletal muscle and nonmuscle tissues. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(67399) PDZ and LIM domain 7
Rat(286908) PDZ and LIM domain 7
Zebrafish(393813) PDZ and LIM domain 7
chicken(416362) PDZ and LIM domain 7 (enigma)
dog(611246) PDZ and LIM domain 7 (enigma)
domestic cat(101086874) PDZ and LIM domain 7 (enigma)
domestic guinea pig(100712754) PDZ and LIM domain 7 (enigma)
naked mole-rat(101715491) PDZ and LIM domain 7 (enigma)
cow(533851) PDZ and LIM domain 7 (enigma)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005451 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134901 MISSION® esiRNA esiRNA human PDLIM7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005451 Rosetta Predictions human pricing
NM_203352 Rosetta Predictions human pricing
NM_213636 Rosetta Predictions human pricing
NM_173125 Rosetta Predictions rat pricing
NM_001114087 Rosetta Predictions mouse pricing
NM_001114088 Rosetta Predictions mouse pricing
NM_026131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087320 predicted 1268
2 SASI_Hs01_00087321 predicted 1358
3 SASI_Hs01_00087322 predicted 976
4 SASI_Hs02_00339611 predicted 976
5 SASI_Hs01_00087323 predicted 914
6 SASI_Hs01_00087324 predicted 1237
7 SASI_Hs01_00087325 predicted 1073
8 SASI_Hs01_00087327 predicted 1236
9 SASI_Hs01_00087328 predicted 1131
10 SASI_Hs01_00087329 predicted 1256
11 SASI_Hs01_00087326 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012774 predicted 1168
2 SASI_Hs01_00012775 predicted 1257
3 SASI_Hs01_00012776 predicted 876
4 SASI_Hs02_00373290 predicted 872
5 SASI_Hs01_00012777 predicted 810
6 SASI_Hs01_00012778 predicted 1134
7 SASI_Hs01_00012779 predicted 970
8 SASI_Hs01_00012781 predicted 1132
9 SASI_Hs01_00012782 predicted 1022
10 SASI_Hs01_00012783 predicted 1150
11 SASI_Hs01_00012780 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195483 predicted 332
2 SASI_Hs02_00374321 predicted 267
3 SASI_Hs01_00195485 predicted 389
4 SASI_Hs01_00195486 predicted 379
5 SASI_Hs01_00195487 predicted 373
6 SASI_Hs01_00195488 predicted 399
7 SASI_Hs01_00195489 predicted 373
8 SASI_Hs01_00195490 predicted 244
9 SASI_Hs01_00195491 predicted 234
10 SASI_Hs01_00195492 predicted 204
11 SASI_Hs01_00195484 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102539 predicted 968
2 SASI_Rn01_00102540 predicted 1242
3 SASI_Rn01_00102541 predicted 1219
4 SASI_Rn02_00269292 predicted 1239
5 SASI_Rn01_00102542 predicted 1466
6 SASI_Rn01_00102545 predicted 937
7 SASI_Rn01_00102546 predicted 1193
8 SASI_Rn01_00102547 predicted 206
9 SASI_Rn01_00102548 predicted 442
10 SASI_Rn02_00269293 predicted 1060
11 SASI_Rn01_00102543 predicted 1380
12 SASI_Rn01_00102544 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308339 predicted 726
2 SASI_Mm02_00308340 predicted 772
3 SASI_Mm02_00308341 predicted 724
4 SASI_Mm02_00308342 predicted 711
5 SASI_Mm02_00308343 predicted 725
6 SASI_Mm02_00308344 predicted 680
7 SASI_Mm02_00308345 predicted 762
8 SASI_Mm02_00308346 predicted 714
9 SASI_Mm02_00308347 predicted 730
10 SASI_Mm02_00308348 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308349 predicted 330
2 SASI_Mm02_00308350 predicted 221
3 SASI_Mm02_00308351 predicted 305
4 SASI_Mm02_00308352 predicted 201
5 SASI_Mm02_00308353 predicted 257
6 SASI_Mm02_00308354 predicted 403
7 SASI_Mm02_00308355 predicted 214
8 SASI_Mm02_00308356 predicted 309
9 SASI_Mm02_00308357 predicted 334
10 SASI_Mm02_00308358 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329720 predicted 620
2 SASI_Mm02_00329721 predicted 669
3 SASI_Mm02_00329722 predicted 630
4 SASI_Mm02_00329723 predicted 615
5 SASI_Mm01_00124164 predicted 627
6 SASI_Mm01_00124167 predicted 577
7 SASI_Mm02_00329724 predicted 656
8 SASI_Mm02_00329725 predicted 611
9 SASI_Mm02_00329726 predicted 620
10 SASI_Mm02_00329727 predicted 620
11 SASI_Mm01_00124159 predicted 414
12 SASI_Mm01_00124160 predicted 216
13 SASI_Mm01_00124161 predicted 416
14 SASI_Mm01_00124162 predicted 571
15 SASI_Mm01_00124163 predicted 413
16 SASI_Mm01_00124165 predicted 519
17 SASI_Mm01_00124166 predicted 561
18 SASI_Mm01_00124168 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026131
VALIDATED
PDLIM7 MISSION shRNA Bacterial Glycerol Stock
PDZ and LIM domain 7 (enigma)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026131.3-830s21c1
Sequence:CCGGTCTTGGCCCTGTGGTACTACTCTCGAGAGTAGTACCACAGGGCCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-424s21c1
Sequence:CCGGCTGATGGAGGATACCGAAGACCTCGAGGTCTTCGGTATCCTCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026131.2-362s1c1
Sequence:CCGGCAGACCTCTGACAAACAGTTGCTCGAGCAACTGTTTGTCAGAGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026131.2-361s1c1
Sequence:CCGGGCAGACCTCTGACAAACAGTTCTCGAGAACTGTTTGTCAGAGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-722s1c1
Sequence:CCGGGCTCTTGCCTACCACTTTCATCTCGAGATGAAAGTGGTAGGCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-223s21c1
Sequence:CCGGGGAGACTGGGTACTGAATATTCTCGAGAATATTCAGTACCCAGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026131.3-868s21c1
Sequence:CCGGTGCCTTTGAGCATGGAAATAACTCGAGTTATTTCCATGCTCAAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026131.3-513s21c1
Sequence:CCGGGTTCATGCAAGACCCGGATGACTCGAGTCATCCGGGTCTTGCATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-572s21c1
Sequence:CCGGAGCTACAGAGCCCACGCTATACTCGAGTATAGCGTGGGCTCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-670s1c1
Sequence:CCGGCTCTGCTTCCTTTCTCTGTTACTCGAGTAACAGAGAAAGGAAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-864s1c1
Sequence:CCGGGCCTTTGAGCATGGAAATAAACTCGAGTTTATTTCCATGCTCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026131.3-362s21c1
Sequence:CCGGAGGTGCAGACCTCTGACAAACCTCGAGGTTTGTCAGAGGTCTGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026131
VALIDATED
PDLIM7 MISSION shRNA shRNA Plasmid DNA
PDZ and LIM domain 7 (enigma)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026131.3-830s21c1
Sequence:CCGGTCTTGGCCCTGTGGTACTACTCTCGAGAGTAGTACCACAGGGCCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-424s21c1
Sequence:CCGGCTGATGGAGGATACCGAAGACCTCGAGGTCTTCGGTATCCTCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026131.2-362s1c1
Sequence:CCGGCAGACCTCTGACAAACAGTTGCTCGAGCAACTGTTTGTCAGAGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026131.2-361s1c1
Sequence:CCGGGCAGACCTCTGACAAACAGTTCTCGAGAACTGTTTGTCAGAGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-722s1c1
Sequence:CCGGGCTCTTGCCTACCACTTTCATCTCGAGATGAAAGTGGTAGGCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-223s21c1
Sequence:CCGGGGAGACTGGGTACTGAATATTCTCGAGAATATTCAGTACCCAGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026131.3-868s21c1
Sequence:CCGGTGCCTTTGAGCATGGAAATAACTCGAGTTATTTCCATGCTCAAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026131.3-513s21c1
Sequence:CCGGGTTCATGCAAGACCCGGATGACTCGAGTCATCCGGGTCTTGCATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-572s21c1
Sequence:CCGGAGCTACAGAGCCCACGCTATACTCGAGTATAGCGTGGGCTCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-670s1c1
Sequence:CCGGCTCTGCTTCCTTTCTCTGTTACTCGAGTAACAGAGAAAGGAAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-864s1c1
Sequence:CCGGGCCTTTGAGCATGGAAATAAACTCGAGTTTATTTCCATGCTCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026131.3-362s21c1
Sequence:CCGGAGGTGCAGACCTCTGACAAACCTCGAGGTTTGTCAGAGGTCTGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026131
VALIDATED
PDLIM7 MISSION shRNA Lentiviral Transduction Particles
PDZ and LIM domain 7 (enigma)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026131.3-830s21c1
Sequence:CCGGTCTTGGCCCTGTGGTACTACTCTCGAGAGTAGTACCACAGGGCCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-424s21c1
Sequence:CCGGCTGATGGAGGATACCGAAGACCTCGAGGTCTTCGGTATCCTCCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026131.2-362s1c1
Sequence:CCGGCAGACCTCTGACAAACAGTTGCTCGAGCAACTGTTTGTCAGAGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026131.2-361s1c1
Sequence:CCGGGCAGACCTCTGACAAACAGTTCTCGAGAACTGTTTGTCAGAGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-722s1c1
Sequence:CCGGGCTCTTGCCTACCACTTTCATCTCGAGATGAAAGTGGTAGGCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-223s21c1
Sequence:CCGGGGAGACTGGGTACTGAATATTCTCGAGAATATTCAGTACCCAGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026131.3-868s21c1
Sequence:CCGGTGCCTTTGAGCATGGAAATAACTCGAGTTATTTCCATGCTCAAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026131.3-513s21c1
Sequence:CCGGGTTCATGCAAGACCCGGATGACTCGAGTCATCCGGGTCTTGCATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026131.3-572s21c1
Sequence:CCGGAGCTACAGAGCCCACGCTATACTCGAGTATAGCGTGGGCTCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-670s1c1
Sequence:CCGGCTCTGCTTCCTTTCTCTGTTACTCGAGTAACAGAGAAAGGAAGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026131.2-864s1c1
Sequence:CCGGGCCTTTGAGCATGGAAATAAACTCGAGTTTATTTCCATGCTCAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026131.3-362s21c1
Sequence:CCGGAGGTGCAGACCTCTGACAAACCTCGAGGTTTGTCAGAGGTCTGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005451
VALIDATED
PDLIM7 MISSION shRNA Bacterial Glycerol Stock
PDZ and LIM domain 7 (enigma)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000159220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1253s1c1
Sequence:CCGGCGAGACTATGAGAAGATGTTTCTCGAGAAACATCTTCTCATAGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1110s1c1
Sequence:CCGGCCAAGTGCAAGAAGAAGATTACTCGAGTAATCTTCTTCTTGCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1123s1c1
Sequence:CCGGGAAGATTACAGGCGAGATCATCTCGAGATGATCTCGCCTGTAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1252s1c1
Sequence:CCGGGCGAGACTATGAGAAGATGTTCTCGAGAACATCTTCTCATAGTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1262s1c1
Sequence:CCGGGAGAAGATGTTTGGCACGAAACTCGAGTTTCGTGCCAAACATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-632s1c1
Sequence:CCGGGATGAGGAGCACCTGAAGAAACTCGAGTTTCTTCAGGTGCTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-640s1c1
Sequence:CCGGGCACCTGAAGAAATCAAGCCACTCGAGTGGCTTGATTTCTTCAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-643s1c1
Sequence:CCGGCCTGAAGAAATCAAGCCAGGTCTCGAGACCTGGCTTGATTTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1363s1c1
Sequence:CCGGCGTCTGTGCGATATGTCAGATCTCGAGATCTGACATATCGCACAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-1252s21c1
Sequence:CCGGGCGAGACTATGAGAAGATGTTCTCGAGAACATCTTCTCATAGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005451.3-1537s21c1
Sequence:CCGGGCTGGCAATGGTTGCCTTAACCTCGAGGTTAAGGCAACCATTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-237s21c1
Sequence:CCGGTGAGCATCGATGGCGAGAATGCTCGAGCATTCTCGCCATCGATGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-632s21c1
Sequence:CCGGGATGAGGAGCACCTGAAGAAACTCGAGTTTCTTCAGGTGCTCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-640s21c1
Sequence:CCGGGCACCTGAAGAAATCAAGCCACTCGAGTGGCTTGATTTCTTCAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005451
VALIDATED
PDLIM7 MISSION shRNA shRNA Plasmid DNA
PDZ and LIM domain 7 (enigma)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000159220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1253s1c1
Sequence:CCGGCGAGACTATGAGAAGATGTTTCTCGAGAAACATCTTCTCATAGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1110s1c1
Sequence:CCGGCCAAGTGCAAGAAGAAGATTACTCGAGTAATCTTCTTCTTGCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1123s1c1
Sequence:CCGGGAAGATTACAGGCGAGATCATCTCGAGATGATCTCGCCTGTAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1252s1c1
Sequence:CCGGGCGAGACTATGAGAAGATGTTCTCGAGAACATCTTCTCATAGTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1262s1c1
Sequence:CCGGGAGAAGATGTTTGGCACGAAACTCGAGTTTCGTGCCAAACATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-632s1c1
Sequence:CCGGGATGAGGAGCACCTGAAGAAACTCGAGTTTCTTCAGGTGCTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-640s1c1
Sequence:CCGGGCACCTGAAGAAATCAAGCCACTCGAGTGGCTTGATTTCTTCAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-643s1c1
Sequence:CCGGCCTGAAGAAATCAAGCCAGGTCTCGAGACCTGGCTTGATTTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1363s1c1
Sequence:CCGGCGTCTGTGCGATATGTCAGATCTCGAGATCTGACATATCGCACAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-1252s21c1
Sequence:CCGGGCGAGACTATGAGAAGATGTTCTCGAGAACATCTTCTCATAGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005451.3-1537s21c1
Sequence:CCGGGCTGGCAATGGTTGCCTTAACCTCGAGGTTAAGGCAACCATTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-237s21c1
Sequence:CCGGTGAGCATCGATGGCGAGAATGCTCGAGCATTCTCGCCATCGATGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-632s21c1
Sequence:CCGGGATGAGGAGCACCTGAAGAAACTCGAGTTTCTTCAGGTGCTCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-640s21c1
Sequence:CCGGGCACCTGAAGAAATCAAGCCACTCGAGTGGCTTGATTTCTTCAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005451
VALIDATED
PDLIM7 MISSION shRNA Lentiviral Transduction Particles
PDZ and LIM domain 7 (enigma)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000159220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1253s1c1
Sequence:CCGGCGAGACTATGAGAAGATGTTTCTCGAGAAACATCTTCTCATAGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1110s1c1
Sequence:CCGGCCAAGTGCAAGAAGAAGATTACTCGAGTAATCTTCTTCTTGCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1123s1c1
Sequence:CCGGGAAGATTACAGGCGAGATCATCTCGAGATGATCTCGCCTGTAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1252s1c1
Sequence:CCGGGCGAGACTATGAGAAGATGTTCTCGAGAACATCTTCTCATAGTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1262s1c1
Sequence:CCGGGAGAAGATGTTTGGCACGAAACTCGAGTTTCGTGCCAAACATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-632s1c1
Sequence:CCGGGATGAGGAGCACCTGAAGAAACTCGAGTTTCTTCAGGTGCTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-640s1c1
Sequence:CCGGGCACCTGAAGAAATCAAGCCACTCGAGTGGCTTGATTTCTTCAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005451.3-643s1c1
Sequence:CCGGCCTGAAGAAATCAAGCCAGGTCTCGAGACCTGGCTTGATTTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005451.3-1363s1c1
Sequence:CCGGCGTCTGTGCGATATGTCAGATCTCGAGATCTGACATATCGCACAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-1252s21c1
Sequence:CCGGGCGAGACTATGAGAAGATGTTCTCGAGAACATCTTCTCATAGTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005451.3-1537s21c1
Sequence:CCGGGCTGGCAATGGTTGCCTTAACCTCGAGGTTAAGGCAACCATTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-237s21c1
Sequence:CCGGTGAGCATCGATGGCGAGAATGCTCGAGCATTCTCGCCATCGATGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-632s21c1
Sequence:CCGGGATGAGGAGCACCTGAAGAAACTCGAGTTTCTTCAGGTGCTCCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005451.3-640s21c1
Sequence:CCGGGCACCTGAAGAAATCAAGCCACTCGAGTGGCTTGATTTCTTCAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)