EMAIL THIS PAGE TO A FRIEND

PDP2

pyruvate dehyrogenase phosphatase catalytic subunit 2

58 Gene Product Result for
Synonyms: PPM2C2
UniProtKB ID: Q9P2J9, A8K924
Gene ID:
Mouse(382051) pyruvate dehyrogenase phosphatase catalytic subunit 2
Rat(246311) pyruvate dehyrogenase phosphatase catalytic subunit 2
domestic guinea pig(100725481) pyruvate dehyrogenase phosphatase catalytic subunit 2
naked mole-rat(101700253) pyruvate dehyrogenase phosphatase catalytic subunit 2
Domestic Rabbit(100350736) pyruvate dehyrogenase phosphatase catalytic subunit 2
cow(100299267) pyruvate dehyrogenase phosphatase catalytic subunit 2
sheep(101105182) pyruvate dehyrogenase phosphatase catalytic subunit 2
Zebrafish(58149) putative pyruvate dehydrogenase phosphatase isoenzyme 2
chicken(427550) pyruvate dehyrogenase phosphatase catalytic subunit 2
Horse(100065629) pyruvate dehyrogenase phosphatase catalytic subunit 2
domestic cat(101095536) pyruvate dehyrogenase phosphatase catalytic subunit 2
dog(489771) pyruvate dehyrogenase phosphatase catalytic subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020786 Rosetta Predictions human pricing
NM_145091 Rosetta Predictions rat pricing
NM_001024606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224093 predicted 1667
2 SASI_Hs02_00353942 predicted 1717
3 SASI_Hs01_00224094 predicted 1843
4 SASI_Hs01_00224095 predicted 461
5 SASI_Hs01_00224096 predicted 246
6 SASI_Hs01_00224097 predicted 383
7 SASI_Hs01_00224098 predicted 395
8 SASI_Hs01_00224099 predicted 562
9 SASI_Hs01_00224100 predicted 1204
10 SASI_Hs01_00224101 predicted 1763
11 SASI_Hs01_00224102 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268686 predicted 1540
2 SASI_Rn01_00032501 predicted 394
3 SASI_Rn01_00032502 predicted 945
4 SASI_Rn01_00032503 predicted 1282
5 SASI_Rn01_00032504 predicted 1307
6 SASI_Rn02_00268687 predicted 1008
7 SASI_Rn01_00032506 predicted 405
8 SASI_Rn01_00032507 predicted 779
9 SASI_Rn01_00032508 predicted 1110
10 SASI_Rn01_00032509 predicted 1246
11 SASI_Rn01_00032505 predicted 448
12 SASI_Rn01_00032510 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050325 predicted 1733
2 SASI_Mm01_00050326 predicted 483
3 SASI_Mm01_00050327 predicted 927
4 SASI_Mm01_00050328 predicted 1242
5 SASI_Mm01_00050329 predicted 1679
6 SASI_Mm01_00050330 predicted 754
7 SASI_Mm01_00050331 predicted 927
8 SASI_Mm01_00050332 predicted 1081
9 SASI_Mm01_00050333 predicted 943
10 SASI_Mm01_00050334 predicted 1294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020786
VALIDATED
PDP2 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehyrogenase phosphatase catalytic subunit 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-453s1c1
Sequence:CCGGCCTTGAAAGCAGAGTCCCAAACTCGAGTTTGGGACTCTGCTTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-1594s1c1
Sequence:CCGGGCCATCGGGAACAATGAGTATCTCGAGATACTCATTGTTCCCGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-810s1c1
Sequence:CCGGGCTTGATTTGCACATGGAAATCTCGAGATTTCCATGTGCAAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_020786.1-1218s1c1
Sequence:CCGGGCTGAAGTGGAGTAAAGAGTTCTCGAGAACTCTTTACTCCACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020786.1-469s1c1
Sequence:CCGGCCAAATTCAGTGTTGCGGTTTCTCGAGAAACCGCAACACTGAATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020786.1-779s21c1
Sequence:CCGGTTGACCACCTCCGTGTCTATTCTCGAGAATAGACACGGAGGTGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020786.1-1268s21c1
Sequence:CCGGATACCGAGGCCCTCAACATTTCTCGAGAAATGTTGAGGGCCTCGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020786.1-1821s21c1
Sequence:CCGGAGCTATCCAAACCTTACTATTCTCGAGAATAGTAAGGTTTGGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020786
VALIDATED
PDP2 MISSION shRNA shRNA Plasmid DNA
pyruvate dehyrogenase phosphatase catalytic subunit 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-453s1c1
Sequence:CCGGCCTTGAAAGCAGAGTCCCAAACTCGAGTTTGGGACTCTGCTTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-1594s1c1
Sequence:CCGGGCCATCGGGAACAATGAGTATCTCGAGATACTCATTGTTCCCGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-810s1c1
Sequence:CCGGGCTTGATTTGCACATGGAAATCTCGAGATTTCCATGTGCAAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_020786.1-1218s1c1
Sequence:CCGGGCTGAAGTGGAGTAAAGAGTTCTCGAGAACTCTTTACTCCACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020786.1-469s1c1
Sequence:CCGGCCAAATTCAGTGTTGCGGTTTCTCGAGAAACCGCAACACTGAATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020786.1-779s21c1
Sequence:CCGGTTGACCACCTCCGTGTCTATTCTCGAGAATAGACACGGAGGTGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020786.1-1268s21c1
Sequence:CCGGATACCGAGGCCCTCAACATTTCTCGAGAAATGTTGAGGGCCTCGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020786.1-1821s21c1
Sequence:CCGGAGCTATCCAAACCTTACTATTCTCGAGAATAGTAAGGTTTGGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020786
VALIDATED
PDP2 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehyrogenase phosphatase catalytic subunit 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-453s1c1
Sequence:CCGGCCTTGAAAGCAGAGTCCCAAACTCGAGTTTGGGACTCTGCTTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-1594s1c1
Sequence:CCGGGCCATCGGGAACAATGAGTATCTCGAGATACTCATTGTTCCCGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020786.1-810s1c1
Sequence:CCGGGCTTGATTTGCACATGGAAATCTCGAGATTTCCATGTGCAAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_020786.1-1218s1c1
Sequence:CCGGGCTGAAGTGGAGTAAAGAGTTCTCGAGAACTCTTTACTCCACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020786.1-469s1c1
Sequence:CCGGCCAAATTCAGTGTTGCGGTTTCTCGAGAAACCGCAACACTGAATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020786.1-779s21c1
Sequence:CCGGTTGACCACCTCCGTGTCTATTCTCGAGAATAGACACGGAGGTGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020786.1-1268s21c1
Sequence:CCGGATACCGAGGCCCTCAACATTTCTCGAGAAATGTTGAGGGCCTCGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020786.1-1821s21c1
Sequence:CCGGAGCTATCCAAACCTTACTATTCTCGAGAATAGTAAGGTTTGGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358697
VALIDATED
PDP2 MISSION shRNA Bacterial Glycerol Stock
pyruvate dehyrogenase phosphatase catalytic subunit 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-1257s1c1
Sequence:CCGGGCCCTCAACATCTACCAGTTTCTCGAGAAACTGGTAGATGTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-1039s1c1
Sequence:CCGGCCTGGTCATGTTTACCTCTTACTCGAGTAAGAGGTAAACATGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-443s1c1
Sequence:CCGGCGGAGTACCAAATTCAGTGTTCTCGAGAACACTGAATTTGGTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-530s1c1
Sequence:CCGGCGTCCAAACGAATGGGATGATCTCGAGATCATCCCATTCGTTTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-815s1c1
Sequence:CCGGGCTGAGCATTGAAGAAGCATTCTCGAGAATGCTTCTTCAATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358697
VALIDATED
PDP2 MISSION shRNA shRNA Plasmid DNA
pyruvate dehyrogenase phosphatase catalytic subunit 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-1257s1c1
Sequence:CCGGGCCCTCAACATCTACCAGTTTCTCGAGAAACTGGTAGATGTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-1039s1c1
Sequence:CCGGCCTGGTCATGTTTACCTCTTACTCGAGTAAGAGGTAAACATGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-443s1c1
Sequence:CCGGCGGAGTACCAAATTCAGTGTTCTCGAGAACACTGAATTTGGTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-530s1c1
Sequence:CCGGCGTCCAAACGAATGGGATGATCTCGAGATCATCCCATTCGTTTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-815s1c1
Sequence:CCGGGCTGAGCATTGAAGAAGCATTCTCGAGAATGCTTCTTCAATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358697
VALIDATED
PDP2 MISSION shRNA Lentiviral Transduction Particles
pyruvate dehyrogenase phosphatase catalytic subunit 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-1257s1c1
Sequence:CCGGGCCCTCAACATCTACCAGTTTCTCGAGAAACTGGTAGATGTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-1039s1c1
Sequence:CCGGCCTGGTCATGTTTACCTCTTACTCGAGTAAGAGGTAAACATGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-443s1c1
Sequence:CCGGCGGAGTACCAAATTCAGTGTTCTCGAGAACACTGAATTTGGTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-530s1c1
Sequence:CCGGCGTCCAAACGAATGGGATGATCTCGAGATCATCCCATTCGTTTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358697.2-815s1c1
Sequence:CCGGGCTGAGCATTGAAGAAGCATTCTCGAGAATGCTTCTTCAATGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)