EMAIL THIS PAGE TO A FRIEND

PDPK1

3-phosphoinositide dependent protein kinase-1

182 Gene Product Result for
Synonyms: PDK1 PDPK2 PRO0461
UniProtKB ID: O15530, H0Y4Z0, Q59EH6, Q6FI20, Q8IV52, Q9BRD5
Gene ID:
Mouse(18607) 3-phosphoinositide dependent protein kinase 1
Rat(81745) 3-phosphoinositide dependent protein kinase-1
chicken(416588) 3-phosphoinositide dependent protein kinase-1
domestic cat(101101686) 3-phosphoinositide dependent protein kinase-1
dog(479875) 3-phosphoinositide dependent protein kinase-1
cow(100138102) 3-phosphoinositide dependent protein kinase-1
sheep(101117211) 3-phosphoinositide dependent protein kinase-1
naked mole-rat(101709940) 3-phosphoinositide dependent protein kinase-1
domestic guinea pig(100735138) 3-phosphoinositide dependent protein kinase-1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302549 ANTI-MOUSE PDPK1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
P3110 Anti-PDK1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
SAB4502160 Anti-PDK1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502161 Anti-PDK1, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
K0266 Anti-PDPK1 (346-360) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300290 Anti-PDPK1 (Ab-241) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1406242 Anti-PDPK1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution mouse, human
proximity ligation assay, western blot pricing
AV30313 Anti-PDPK1 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, rat, human, pig
western blot pricing
HPA035199 Anti-PDPK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA068961 Anti-PDPK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4504514 Anti-phospho-PDK1 (pSer241) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301281 Anti-phospho-PDK1 (pTyr9) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4300004 Anti-phospho-PDPK1 (pSer241) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402866 Monoclonal Anti-PDPK1, (C-terminal) antibody produced in mouse clone 2E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011062 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011062 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011062 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002613 Rosetta Predictions human pricing
NM_031268 Rosetta Predictions human pricing
NM_031081 Rosetta Predictions rat pricing
NM_001080773 Rosetta Predictions mouse pricing
NM_011062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044485 predicted 1065
2 SASI_Hs02_00334126 predicted 2257
3 SASI_Hs01_00044486 predicted 1360
4 SASI_Hs01_00044487 predicted 1141
5 SASI_Hs01_00044488 predicted 1431
6 SASI_Hs01_00044489 predicted 1066
7 SASI_Hs01_00044490 predicted 1527
8 SASI_Hs01_00044491 predicted 1406
9 SASI_Hs01_00044492 predicted 1476
10 SASI_Hs01_00044493 predicted 1467
11 SASI_Hs01_00044494 predicted 2224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094378 predicted 678
2 SASI_Hs02_00358679 predicted 1871
3 SASI_Hs01_00094379 predicted 984
4 SASI_Hs01_00094380 predicted 763
5 SASI_Hs01_00094381 predicted 1053
6 SASI_Hs01_00094382 predicted 688
7 SASI_Hs01_00094383 predicted 1142
8 SASI_Hs01_00094384 predicted 1027
9 SASI_Hs01_00094385 predicted 1101
10 SASI_Hs01_00094386 predicted 1091
11 SASI_Hs01_00094387 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119805 predicted 621
2 SASI_Rn01_00119806 predicted 772
3 SASI_Rn02_00264321 predicted 1484
4 SASI_Rn01_00119807 predicted 350
5 SASI_Rn01_00119808 predicted 775
6 SASI_Rn01_00119809 predicted 1449
7 SASI_Rn01_00119811 predicted 856
8 SASI_Rn01_00119812 predicted 914
9 SASI_Rn01_00119813 predicted 405
10 SASI_Rn01_00119814 predicted 1309
11 SASI_Rn01_00119810 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293693 predicted 421
2 SASI_Mm02_00293694 predicted 361
3 SASI_Mm02_00293695 predicted 975
4 SASI_Mm02_00293696 predicted 494
5 SASI_Mm02_00293697 predicted 921
6 SASI_Mm02_00293698 predicted 630
7 SASI_Mm02_00293699 predicted 847
8 SASI_Mm02_00293700 predicted 1180
9 SASI_Mm02_00293701 predicted 474
10 SASI_Mm02_00293702 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074632 predicted 423
2 SASI_Mm02_00319826 predicted 358
3 SASI_Mm01_00074634 predicted 977
4 SASI_Mm02_00319827 predicted 505
5 SASI_Mm01_00074635 predicted 930
6 SASI_Mm01_00074636 predicted 640
7 SASI_Mm01_00074637 predicted 850
8 SASI_Mm01_00074638 predicted 1184
9 SASI_Mm01_00074639 predicted 478
10 SASI_Mm02_00319828 predicted 1394
11 SASI_Mm01_00074633 predicted 1500
12 SASI_Mm01_00074640 predicted 1573
13 SASI_Mm01_00074641 predicted 1552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011062
VALIDATED
PDPK1 MISSION shRNA Bacterial Glycerol Stock
3-phosphoinositide dependent protein kinase-1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-478s21c1
Sequence:CCGGTTCTGGAGAAACGTCATATTACTCGAGTAATATGACGTTTCTCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-993s21c1
Sequence:CCGGGCCGGGAATGAATATCTTATACTCGAGTATAAGATATTCATTCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011062.4-1608s21c1
Sequence:CCGGCCTGTCAACAAGGTCTTGAAACTCGAGTTTCAAGACCTTGTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-667s21c1
Sequence:CCGGGCTCATTTGATGAGACCTGTACTCGAGTACAGGTCTCATCAAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-633s1c1
Sequence:CCGGGCTCATTTGATGAGACCTGTACTCGAGTACAGGTCTCATCAAATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011062.1-1529s1c1
Sequence:CCGGCGACAGTTATTACTCACAGAACTCGAGTTCTGTGAGTAATAACTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-959s1c1
Sequence:CCGGGCCGGGAATGAATATCTTATACTCGAGTATAAGATATTCATTCCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-668s1c1
Sequence:CCGGGCTGAGATTGTGTCTGCTTTACTCGAGTAAAGCAGACACAATCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-1574s1c1
Sequence:CCGGCCTGTCAACAAGGTCTTGAAACTCGAGTTTCAAGACCTTGTTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011062
VALIDATED
PDPK1 MISSION shRNA shRNA Plasmid DNA
3-phosphoinositide dependent protein kinase-1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-478s21c1
Sequence:CCGGTTCTGGAGAAACGTCATATTACTCGAGTAATATGACGTTTCTCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-993s21c1
Sequence:CCGGGCCGGGAATGAATATCTTATACTCGAGTATAAGATATTCATTCCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011062.4-1608s21c1
Sequence:CCGGCCTGTCAACAAGGTCTTGAAACTCGAGTTTCAAGACCTTGTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-667s21c1
Sequence:CCGGGCTCATTTGATGAGACCTGTACTCGAGTACAGGTCTCATCAAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-633s1c1
Sequence:CCGGGCTCATTTGATGAGACCTGTACTCGAGTACAGGTCTCATCAAATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011062.1-1529s1c1
Sequence:CCGGCGACAGTTATTACTCACAGAACTCGAGTTCTGTGAGTAATAACTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-959s1c1
Sequence:CCGGGCCGGGAATGAATATCTTATACTCGAGTATAAGATATTCATTCCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-668s1c1
Sequence:CCGGGCTGAGATTGTGTCTGCTTTACTCGAGTAAAGCAGACACAATCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-1574s1c1
Sequence:CCGGCCTGTCAACAAGGTCTTGAAACTCGAGTTTCAAGACCTTGTTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011062
VALIDATED
PDPK1 MISSION shRNA Lentiviral Transduction Particles
3-phosphoinositide dependent protein kinase-1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-478s21c1
Sequence:CCGGTTCTGGAGAAACGTCATATTACTCGAGTAATATGACGTTTCTCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-993s21c1
Sequence:CCGGGCCGGGAATGAATATCTTATACTCGAGTATAAGATATTCATTCCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011062.4-1608s21c1
Sequence:CCGGCCTGTCAACAAGGTCTTGAAACTCGAGTTTCAAGACCTTGTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011062.4-667s21c1
Sequence:CCGGGCTCATTTGATGAGACCTGTACTCGAGTACAGGTCTCATCAAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-633s1c1
Sequence:CCGGGCTCATTTGATGAGACCTGTACTCGAGTACAGGTCTCATCAAATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011062.1-1529s1c1
Sequence:CCGGCGACAGTTATTACTCACAGAACTCGAGTTCTGTGAGTAATAACTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-959s1c1
Sequence:CCGGGCCGGGAATGAATATCTTATACTCGAGTATAAGATATTCATTCCCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-668s1c1
Sequence:CCGGGCTGAGATTGTGTCTGCTTTACTCGAGTAAAGCAGACACAATCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011062.1-1574s1c1
Sequence:CCGGCCTGTCAACAAGGTCTTGAAACTCGAGTTTCAAGACCTTGTTGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002613
VALIDATED
PDPK1 MISSION shRNA Bacterial Glycerol Stock
3-phosphoinositide dependent protein kinase-1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1533s21c1
Sequence:CCGGGGATAAGCGGAAGGGTTTATTCTCGAGAATAAACCCTTCCGCTTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1696s21c1
Sequence:CCGGACGCCTAACAGGACGTATTATCTCGAGATAATACGTCCTGTTAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002613.3-5632s21c1
Sequence:CCGGTATAGACTCAGAAGGTATATTCTCGAGAATATACCTTCTGAGTCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1656s21c1
Sequence:CCGGTCGACCAGAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTCTGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1253s21c1
Sequence:CCGGAGGACTGCTATGGCAATTATGCTCGAGCATAATTGCCATAGCAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002613.3-676s1c1
Sequence:CCGGGATGAGACCTGTACCCGATTTCTCGAGAAATCGGGTACAGGTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002613.3-562s1c1
Sequence:CCGGCCCTTCTTTGTTAAGCTTTACCTCGAGGTAAAGCTTAACAAAGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002613.3-5642s1c1
Sequence:CCGGGAAGGTATATTAGGACATTTGCTCGAGCAAATGTCCTAATATACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.1-542s1c1
Sequence:CCGGGCTGTATTTCGGCCTTAGTTACTCGAGTAACTAAGGCCGAAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_002613.1-1553s1c1
Sequence:CCGGCAAAGTTCTGAAAGGTGAAATCTCGAGATTTCACCTTTCAGAACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.1-1373s1c1
Sequence:CCGGCGAAGATGAGAAGAGGTTGTTCTCGAGAACAACCTCTTCTCATCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1310s1c1
Sequence:CCGGCAACATAGAGCAGTACATTCACTCGAGTGAATGTACTGCTCTATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1592s1c1
Sequence:CCGGTCGACCAGAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTCTGGTCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1476s1c1
Sequence:CCGGCGGAAGGGTTTATTTGCAAGACTCGAGTCTTGCAAATAAACCCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1466s1c1
Sequence:CCGGAGTGGATAAGCGGAAGGGTTTCTCGAGAAACCCTTCCGCTTATCCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1513s1c1
Sequence:CCGGTCACAGAAGGACCACATTTATCTCGAGATAAATGTGGTCCTTCTGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1306s1c1
Sequence:CCGGGCAGCAACATAGAGCAGTACACTCGAGTGTACTGCTCTATGTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1470s1c1
Sequence:CCGGATAAGCGGAAGGGTTTATTTCTCGAGAAATAAACCCTTCCGCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002613
VALIDATED
PDPK1 MISSION shRNA shRNA Plasmid DNA
3-phosphoinositide dependent protein kinase-1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1533s21c1
Sequence:CCGGGGATAAGCGGAAGGGTTTATTCTCGAGAATAAACCCTTCCGCTTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1696s21c1
Sequence:CCGGACGCCTAACAGGACGTATTATCTCGAGATAATACGTCCTGTTAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002613.3-5632s21c1
Sequence:CCGGTATAGACTCAGAAGGTATATTCTCGAGAATATACCTTCTGAGTCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1656s21c1
Sequence:CCGGTCGACCAGAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTCTGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1253s21c1
Sequence:CCGGAGGACTGCTATGGCAATTATGCTCGAGCATAATTGCCATAGCAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002613.3-676s1c1
Sequence:CCGGGATGAGACCTGTACCCGATTTCTCGAGAAATCGGGTACAGGTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002613.3-562s1c1
Sequence:CCGGCCCTTCTTTGTTAAGCTTTACCTCGAGGTAAAGCTTAACAAAGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002613.3-5642s1c1
Sequence:CCGGGAAGGTATATTAGGACATTTGCTCGAGCAAATGTCCTAATATACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.1-542s1c1
Sequence:CCGGGCTGTATTTCGGCCTTAGTTACTCGAGTAACTAAGGCCGAAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_002613.1-1553s1c1
Sequence:CCGGCAAAGTTCTGAAAGGTGAAATCTCGAGATTTCACCTTTCAGAACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.1-1373s1c1
Sequence:CCGGCGAAGATGAGAAGAGGTTGTTCTCGAGAACAACCTCTTCTCATCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1310s1c1
Sequence:CCGGCAACATAGAGCAGTACATTCACTCGAGTGAATGTACTGCTCTATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1592s1c1
Sequence:CCGGTCGACCAGAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTCTGGTCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1476s1c1
Sequence:CCGGCGGAAGGGTTTATTTGCAAGACTCGAGTCTTGCAAATAAACCCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1466s1c1
Sequence:CCGGAGTGGATAAGCGGAAGGGTTTCTCGAGAAACCCTTCCGCTTATCCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1513s1c1
Sequence:CCGGTCACAGAAGGACCACATTTATCTCGAGATAAATGTGGTCCTTCTGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1306s1c1
Sequence:CCGGGCAGCAACATAGAGCAGTACACTCGAGTGTACTGCTCTATGTTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1470s1c1
Sequence:CCGGATAAGCGGAAGGGTTTATTTCTCGAGAAATAAACCCTTCCGCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002613
VALIDATED
PDPK1 MISSION shRNA Lentiviral Transduction Particles
3-phosphoinositide dependent protein kinase-1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1533s21c1
Sequence:CCGGGGATAAGCGGAAGGGTTTATTCTCGAGAATAAACCCTTCCGCTTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1696s21c1
Sequence:CCGGACGCCTAACAGGACGTATTATCTCGAGATAATACGTCCTGTTAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002613.3-5632s21c1
Sequence:CCGGTATAGACTCAGAAGGTATATTCTCGAGAATATACCTTCTGAGTCTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1656s21c1
Sequence:CCGGTCGACCAGAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTCTGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002613.3-1253s21c1
Sequence:CCGGAGGACTGCTATGGCAATTATGCTCGAGCATAATTGCCATAGCAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002613.3-676s1c1
Sequence:CCGGGATGAGACCTGTACCCGATTTCTCGAGAAATCGGGTACAGGTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002613.3-562s1c1
Sequence:CCGGCCCTTCTTTGTTAAGCTTTACCTCGAGGTAAAGCTTAACAAAGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196433    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002613.3-5642s1c1
Sequence:CCGGGAAGGTATATTAGGACATTTGCTCGAGCAAATGTCCTAATATACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.1-542s1c1
Sequence:CCGGGCTGTATTTCGGCCTTAGTTACTCGAGTAACTAAGGCCGAAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_002613.1-1553s1c1
Sequence:CCGGCAAAGTTCTGAAAGGTGAAATCTCGAGATTTCACCTTTCAGAACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.1-1373s1c1
Sequence:CCGGCGAAGATGAGAAGAGGTTGTTCTCGAGAACAACCTCTTCTCATCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1310s1c1
Sequence:CCGGCAACATAGAGCAGTACATTCACTCGAGTGAATGTACTGCTCTATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1592s1c1
Sequence:CCGGTCGACCAGAGGCCAAGAATTTCTCGAGAAATTCTTGGCCTCTGGTCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1476s1c1
Sequence:CCGGCGGAAGGGTTTATTTGCAAGACTCGAGTCTTGCAAATAAACCCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1466s1c1
Sequence:CCGGAGTGGATAAGCGGAAGGGTTTCTCGAGAAACCCTTCCGCTTATCCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1513s1c1
Sequence:CCGGTCACAGAAGGACCACATTTATCTCGAGATAAATGTGGTCCTTCTGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002613.x-1306s1c1
Sequence:CCGGGCAGCAACATAGAGCAGTACACTCGAGTGTACTGCTCTATGTTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002613.x-1470s1c1
Sequence:CCGGATAAGCGGAAGGGTTTATTTCTCGAGAAATAAACCCTTCCGCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)