EMAIL THIS PAGE TO A FRIEND

PDPN

podoplanin

172 Gene Product Result for
Synonyms: AGGRUS GP36 GP40 Gp38 HT1A-1 OTS8 PA2.26 T1A T1A-2
Gene ID:
Human(10630) Summary: This gene encodes a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined but it has been proposed as a marker of lung injury. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(14726) podoplanin
Rat(54320) podoplanin
chicken(768390) podoplanin
dog(403886) podoplanin
cow(509732) podoplanin
sheep(101112240) podoplanin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501272 Anti-PDPN antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, western blot pricing
HPA007534 Anti-PDPN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
AV44528 Anti-PDPN antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2101763 Anti-PDPN antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA073453 Anti-PDPN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
P1995 Anti-Podoplanin (HG-19) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat
immunofluorescence, western blot pricing
SAB1305961 ANTI-PODOPLANIN / GP36 / T1A-2(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
P5374 Anti-Podoplanin antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human
immunohistochemistry, western blot pricing
P0085 Monoclonal Anti-Podoplanin antibody produced in rat ~1.5 mg/mL, clone NZ-1.2, purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunocytochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010329 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010329 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010329 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006624 Rosetta Predictions human pricing
NM_001006625 Rosetta Predictions human pricing
NM_006474 Rosetta Predictions human pricing
NM_198389 Rosetta Predictions human pricing
NM_019358 Rosetta Predictions rat pricing
NM_010329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192618 predicted 1075
2 SASI_Hs01_00192619 predicted 866
3 SASI_Hs01_00192620 predicted 532
4 SASI_Hs01_00192621 predicted 771
5 SASI_Hs01_00192622 predicted 465
6 SASI_Hs02_00305099 predicted 771
7 SASI_Hs01_00192623 predicted 525
8 SASI_Hs01_00192624 predicted 537
9 SASI_Hs01_00192625 predicted 277
10 SASI_Hs01_00192627 predicted 455
11 SASI_Hs01_00192626 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068555 predicted 1069
2 SASI_Hs01_00068556 predicted 855
3 SASI_Hs01_00068557 predicted 537
4 SASI_Hs01_00068558 predicted 761
5 SASI_Hs01_00068559 predicted 459
6 SASI_Hs02_00305100 predicted 763
7 SASI_Hs02_00305101 predicted 526
8 SASI_Hs01_00068560 predicted 541
9 SASI_Hs01_00068561 predicted 576
10 SASI_Hs01_00068562 predicted 274
11 SASI_Hs01_00068563 predicted 312
12 SASI_Hs01_00068564 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094891 predicted 1242
2 SASI_Hs01_00094892 predicted 1038
3 SASI_Hs01_00094893 predicted 69
4 SASI_Hs01_00094894 predicted 932
5 SASI_Hs01_00094895 predicted 948
6 SASI_Hs01_00094897 predicted 712
7 SASI_Hs01_00094898 predicted 446
8 SASI_Hs02_00341650 predicted 446
9 SASI_Hs01_00094900 predicted 626
10 SASI_Hs02_00341651 predicted 631
11 SASI_Hs01_00094896 predicted 641
12 SASI_Hs01_00094899 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124826 predicted 1242
2 SASI_Hs01_00124827 predicted 1028
3 SASI_Hs01_00124828 predicted 68
4 SASI_Hs01_00124829 predicted 927
5 SASI_Hs01_00124830 predicted 939
6 SASI_Hs01_00124832 predicted 712
7 SASI_Hs01_00124833 predicted 451
8 SASI_Hs01_00124834 predicted 754
9 SASI_Hs02_00371903 predicted 447
10 SASI_Hs02_00371904 predicted 627
11 SASI_Hs01_00124831 predicted 640
12 SASI_Hs01_00124835 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094481 predicted 1011
2 SASI_Rn01_00094482 predicted 926
3 SASI_Rn01_00094483 predicted 698
4 SASI_Rn01_00094484 predicted 395
5 SASI_Rn01_00094485 predicted 728
6 SASI_Rn01_00094486 predicted 1157
7 SASI_Rn01_00094487 predicted 670
8 SASI_Rn01_00094488 predicted 1034
9 SASI_Rn01_00094489 predicted 971
10 SASI_Rn01_00094490 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116397 predicted 408
2 SASI_Mm01_00116399 predicted 996
3 SASI_Mm01_00116401 predicted 764
4 SASI_Mm01_00116400 predicted 768
5 SASI_Mm01_00116402 predicted 534
6 SASI_Mm02_00318336 predicted 749
7 SASI_Mm01_00116404 predicted 531
8 SASI_Mm01_00116405 predicted 681
9 SASI_Mm01_00116406 predicted 646
10 SASI_Mm02_00318337 predicted 989
11 SASI_Mm01_00116398 predicted 548
12 SASI_Mm01_00116403 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006474
PDPN MISSION shRNA Bacterial Glycerol Stock
podoplanin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006474.4-1738s1c1
Sequence:CCGGGCCTCTGGTATGAGAAATAAACTCGAGTTTATTTCTCATACCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-453s1c1
Sequence:CCGGGCTATAAGTCTGGCTTGACAACTCGAGTTGTCAAGCCAGACTTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-259s1c1
Sequence:CCGGCAACAACTCAACGGGAACGATCTCGAGATCGTTCCCGTTGAGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-482s1c1
Sequence:CCGGGCAACAAGTGTCAACAGTGTACTCGAGTACACTGTTGACACTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-703s1c1
Sequence:CCGGCGGCTTCATTGGTGCAATCATCTCGAGATGATTGCACCAATGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-544s21c1
Sequence:CCGGAGTCCACGCGCAAGAACAAAGCTCGAGCTTTGTTCTTGCGCGTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-505s21c1
Sequence:CCGCAGGCATTCGCATCGAGGATCTCTCGAGAGATCCTCGATGCGAATGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-762s21c1
Sequence:CCGGCCTAAAGAGCTGAAGGGTTACCTCGAGGTAACCCTTCAGCTCTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-663s21c1
Sequence:CCGGTGACCCTGGTTGGAATCATAGCTCGAGCTATGATTCCAACCAGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006474
PDPN MISSION shRNA shRNA Plasmid DNA
podoplanin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006474.4-1738s1c1
Sequence:CCGGGCCTCTGGTATGAGAAATAAACTCGAGTTTATTTCTCATACCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-453s1c1
Sequence:CCGGGCTATAAGTCTGGCTTGACAACTCGAGTTGTCAAGCCAGACTTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-259s1c1
Sequence:CCGGCAACAACTCAACGGGAACGATCTCGAGATCGTTCCCGTTGAGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-482s1c1
Sequence:CCGGGCAACAAGTGTCAACAGTGTACTCGAGTACACTGTTGACACTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-703s1c1
Sequence:CCGGCGGCTTCATTGGTGCAATCATCTCGAGATGATTGCACCAATGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-544s21c1
Sequence:CCGGAGTCCACGCGCAAGAACAAAGCTCGAGCTTTGTTCTTGCGCGTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-505s21c1
Sequence:CCGCAGGCATTCGCATCGAGGATCTCTCGAGAGATCCTCGATGCGAATGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-762s21c1
Sequence:CCGGCCTAAAGAGCTGAAGGGTTACCTCGAGGTAACCCTTCAGCTCTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-663s21c1
Sequence:CCGGTGACCCTGGTTGGAATCATAGCTCGAGCTATGATTCCAACCAGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006474
PDPN MISSION shRNA Lentiviral Transduction Particles
podoplanin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006474.4-1738s1c1
Sequence:CCGGGCCTCTGGTATGAGAAATAAACTCGAGTTTATTTCTCATACCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-453s1c1
Sequence:CCGGGCTATAAGTCTGGCTTGACAACTCGAGTTGTCAAGCCAGACTTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-259s1c1
Sequence:CCGGCAACAACTCAACGGGAACGATCTCGAGATCGTTCCCGTTGAGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-482s1c1
Sequence:CCGGGCAACAAGTGTCAACAGTGTACTCGAGTACACTGTTGACACTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006474.4-703s1c1
Sequence:CCGGCGGCTTCATTGGTGCAATCATCTCGAGATGATTGCACCAATGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-544s21c1
Sequence:CCGGAGTCCACGCGCAAGAACAAAGCTCGAGCTTTGTTCTTGCGCGTGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-505s21c1
Sequence:CCGCAGGCATTCGCATCGAGGATCTCTCGAGAGATCCTCGATGCGAATGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-762s21c1
Sequence:CCGGCCTAAAGAGCTGAAGGGTTACCTCGAGGTAACCCTTCAGCTCTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006474.4-663s21c1
Sequence:CCGGTGACCCTGGTTGGAATCATAGCTCGAGCTATGATTCCAACCAGGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010329
VALIDATED
PDPN MISSION shRNA Bacterial Glycerol Stock
podoplanin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010329.1-458s1c1
Sequence:CCGGGAGAGTACAACCACTGTCAAACTCGAGTTTGACAGTGGTTGTACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-548s1c1
Sequence:CCGGCAGACAACAGATAAGAAAGATCTCGAGATCTTTCTTATCTGTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-705s1c1
Sequence:CCGGGTTCTCCCAACACATCTGAAACTCGAGTTTCAGATGTGTTGGGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-1279s1c1
Sequence:CCGGGCTGCATCTTTCTGGATAATACTCGAGTATTATCCAGAAAGATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-1368s21c1
Sequence:CCGGGCTGCATCTTTCTGGATAATACTCGAGTATTATCCAGAAAGATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-413s21c1
Sequence:CCGGGTGCTACTGGAGGGCTTAATGCTCGAGCATTAAGCCCTCCAGTAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-792s21c1
Sequence:CCGGGTTCTCCCAACACATCTGAAACTCGAGTTTCAGATGTGTTGGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-634s21c1
Sequence:CCGGCAGACAACAGATAAGAAAGATCTCGAGATCTTTCTTATCTGTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010329
VALIDATED
PDPN MISSION shRNA shRNA Plasmid DNA
podoplanin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010329.1-458s1c1
Sequence:CCGGGAGAGTACAACCACTGTCAAACTCGAGTTTGACAGTGGTTGTACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-548s1c1
Sequence:CCGGCAGACAACAGATAAGAAAGATCTCGAGATCTTTCTTATCTGTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-705s1c1
Sequence:CCGGGTTCTCCCAACACATCTGAAACTCGAGTTTCAGATGTGTTGGGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-1279s1c1
Sequence:CCGGGCTGCATCTTTCTGGATAATACTCGAGTATTATCCAGAAAGATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-1368s21c1
Sequence:CCGGGCTGCATCTTTCTGGATAATACTCGAGTATTATCCAGAAAGATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-413s21c1
Sequence:CCGGGTGCTACTGGAGGGCTTAATGCTCGAGCATTAAGCCCTCCAGTAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-792s21c1
Sequence:CCGGGTTCTCCCAACACATCTGAAACTCGAGTTTCAGATGTGTTGGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-634s21c1
Sequence:CCGGCAGACAACAGATAAGAAAGATCTCGAGATCTTTCTTATCTGTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010329
VALIDATED
PDPN MISSION shRNA Lentiviral Transduction Particles
podoplanin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010329.1-458s1c1
Sequence:CCGGGAGAGTACAACCACTGTCAAACTCGAGTTTGACAGTGGTTGTACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-548s1c1
Sequence:CCGGCAGACAACAGATAAGAAAGATCTCGAGATCTTTCTTATCTGTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-705s1c1
Sequence:CCGGGTTCTCCCAACACATCTGAAACTCGAGTTTCAGATGTGTTGGGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010329.1-1279s1c1
Sequence:CCGGGCTGCATCTTTCTGGATAATACTCGAGTATTATCCAGAAAGATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-1368s21c1
Sequence:CCGGGCTGCATCTTTCTGGATAATACTCGAGTATTATCCAGAAAGATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-413s21c1
Sequence:CCGGGTGCTACTGGAGGGCTTAATGCTCGAGCATTAAGCCCTCCAGTAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-792s21c1
Sequence:CCGGGTTCTCCCAACACATCTGAAACTCGAGTTTCAGATGTGTTGGGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010329.2-634s21c1
Sequence:CCGGCAGACAACAGATAAGAAAGATCTCGAGATCTTTCTTATCTGTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)