EMAIL THIS PAGE TO A FRIEND

PDRG1

p53 and DNA-damage regulated 1

103 Gene Product Result for
Synonyms: C20orf126 PDRG
UniProtKB ID: Q9NUG6, B2R511, Q96GP3, Q9BUW8
Gene ID:
Mouse(68559) p53 and DNA damage regulated 1
Rat(296278) p53 and DNA damage regulated 1
Zebrafish(550453) p53 and DNA-damage regulated 1
dog(477190) p53 and DNA-damage regulated 1
domestic cat(101095330) p53 and DNA-damage regulated 1
chicken(771852) p53 and DNA-damage regulated 1
cow(768241) p53 and DNA-damage regulated 1
sheep(101103497) p53 and DNA-damage regulated 1
domestic guinea pig(100720735) p53 and DNA-damage regulated 1
naked mole-rat(101710745) p53 and DNA-damage regulated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030815 Rosetta Predictions human pricing
NM_001014762 Rosetta Predictions rat pricing
NM_178939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043159 predicted 968
2 SASI_Hs01_00043160 predicted 903
3 SASI_Hs01_00043161 predicted 284
4 SASI_Hs01_00043162 predicted 899
5 SASI_Hs01_00043163 predicted 323
6 SASI_Hs01_00043164 predicted 203
7 SASI_Hs02_00358394 predicted 888
8 SASI_Hs01_00043165 predicted 510
9 SASI_Hs01_00043166 predicted 572
10 SASI_Hs01_00043167 predicted 1004
11 SASI_Hs01_00043168 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030968 predicted 311
2 SASI_Rn01_00030969 predicted 621
3 SASI_Rn01_00030970 predicted 193
4 SASI_Rn01_00030971 predicted 487
5 SASI_Rn01_00030972 predicted 381
6 SASI_Rn01_00030973 predicted 519
7 SASI_Rn01_00030974 predicted 516
8 SASI_Rn01_00030975 predicted 332
9 SASI_Rn01_00030976 predicted 394
10 SASI_Rn02_00201850 predicted 199
11 SASI_Rn01_00030977 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031583 predicted 229
2 SASI_Mm01_00031584 predicted 661
3 SASI_Mm02_00349573 predicted 264
4 SASI_Mm01_00031586 predicted 514
5 SASI_Mm02_00349574 predicted 551
6 SASI_Mm01_00031588 predicted 854
7 SASI_Mm01_00031590 predicted 880
8 SASI_Mm01_00031591 predicted 341
9 SASI_Mm02_00349575 predicted 785
10 SASI_Mm01_00031589 predicted 804
11 SASI_Mm01_00031585 predicted 934
12 SASI_Mm01_00031587 predicted 593
13 SASI_Mm01_00031592 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030815
VALIDATED
PDRG1 MISSION shRNA Bacterial Glycerol Stock
p53 and DNA-damage regulated 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030815.2-475s21c1
Sequence:CCGGTCAACCAGGATGAGCTTAAAGCTCGAGCTTTAAGCTCATCCTGGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-290s1c1
Sequence:CCGGGATGGTTTGCTTCGGGAACATCTCGAGATGTTCCCGAAGCAAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-152s1c1
Sequence:CCGGGTACCTTGTAGAAGTGGAGGACTCGAGTCCTCCACTTCTACAAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-298s1c1
Sequence:CCGGGCTTCGGGAACATGTTTATCACTCGAGTGATAAACATGTTCCCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-330s1c1
Sequence:CCGGCCTGAGACAAAGGAAATGATTCTCGAGAATCATTTCCTTTGTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-479s1c1
Sequence:CCGGCCAGGATGAGCTTAAAGCTCTCTCGAGAGAGCTTTAAGCTCATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-654s1c1
Sequence:CCGGCCTCTTTGTAGTGCTTGGCTACTCGAGTAGCCAAGCACTACAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030815.2-632s1c1
Sequence:CCGGGTCAGGAATCTGGCCATGAAACTCGAGTTTCATGGCCAGATTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030815.2-207s21c1
Sequence:CCGCATTGTGGACCTGGACACTAAACTCGAGTTTAGTGTCCAGGTCCACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-206s1c1
Sequence:CCGGGATTGTGGACCTGGACACTAACTCGAGTTAGTGTCCAGGTCCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030815
VALIDATED
PDRG1 MISSION shRNA shRNA Plasmid DNA
p53 and DNA-damage regulated 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030815.2-475s21c1
Sequence:CCGGTCAACCAGGATGAGCTTAAAGCTCGAGCTTTAAGCTCATCCTGGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-290s1c1
Sequence:CCGGGATGGTTTGCTTCGGGAACATCTCGAGATGTTCCCGAAGCAAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-152s1c1
Sequence:CCGGGTACCTTGTAGAAGTGGAGGACTCGAGTCCTCCACTTCTACAAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-298s1c1
Sequence:CCGGGCTTCGGGAACATGTTTATCACTCGAGTGATAAACATGTTCCCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-330s1c1
Sequence:CCGGCCTGAGACAAAGGAAATGATTCTCGAGAATCATTTCCTTTGTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-479s1c1
Sequence:CCGGCCAGGATGAGCTTAAAGCTCTCTCGAGAGAGCTTTAAGCTCATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-654s1c1
Sequence:CCGGCCTCTTTGTAGTGCTTGGCTACTCGAGTAGCCAAGCACTACAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030815.2-632s1c1
Sequence:CCGGGTCAGGAATCTGGCCATGAAACTCGAGTTTCATGGCCAGATTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030815.2-207s21c1
Sequence:CCGCATTGTGGACCTGGACACTAAACTCGAGTTTAGTGTCCAGGTCCACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-206s1c1
Sequence:CCGGGATTGTGGACCTGGACACTAACTCGAGTTAGTGTCCAGGTCCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030815
VALIDATED
PDRG1 MISSION shRNA Lentiviral Transduction Particles
p53 and DNA-damage regulated 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030815.2-475s21c1
Sequence:CCGGTCAACCAGGATGAGCTTAAAGCTCGAGCTTTAAGCTCATCCTGGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-290s1c1
Sequence:CCGGGATGGTTTGCTTCGGGAACATCTCGAGATGTTCCCGAAGCAAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-152s1c1
Sequence:CCGGGTACCTTGTAGAAGTGGAGGACTCGAGTCCTCCACTTCTACAAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-298s1c1
Sequence:CCGGGCTTCGGGAACATGTTTATCACTCGAGTGATAAACATGTTCCCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-330s1c1
Sequence:CCGGCCTGAGACAAAGGAAATGATTCTCGAGAATCATTTCCTTTGTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-479s1c1
Sequence:CCGGCCAGGATGAGCTTAAAGCTCTCTCGAGAGAGCTTTAAGCTCATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030815.2-654s1c1
Sequence:CCGGCCTCTTTGTAGTGCTTGGCTACTCGAGTAGCCAAGCACTACAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139874    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030815.2-632s1c1
Sequence:CCGGGTCAGGAATCTGGCCATGAAACTCGAGTTTCATGGCCAGATTCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030815.2-207s21c1
Sequence:CCGCATTGTGGACCTGGACACTAAACTCGAGTTTAGTGTCCAGGTCCACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030815.2-206s1c1
Sequence:CCGGGATTGTGGACCTGGACACTAACTCGAGTTAGTGTCCAGGTCCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178939
VALIDATED
PDRG1 MISSION shRNA Bacterial Glycerol Stock
p53 and DNA-damage regulated 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.1-273s1c1
Sequence:CCGGCCCTAAGACGAAGGAAATGATCTCGAGATCATTTCCTTCGTCTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.2-222s1c1
Sequence:CCGGCTCTGAAGATGTGATGGTTTGCTCGAGCAAACCATCACATCTTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178939.2-331s21c1
Sequence:CCGGAGGCTGCGGAGTCAACTTAAACTCGAGTTTAAGTTGACTCCGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178939.2-302s21c1
Sequence:CCGGATCAAGAGCACCTGGATAAAGCTCGAGCTTTATCCAGGTGCTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178939.2-353s21c1
Sequence:CCGGTGAAAGTTAACCGCCTCTTTGCTCGAGCAAAGAGGCGGTTAACTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178939.2-662s21c1
Sequence:CCGGGCTTGGACACAAGACCTATTGCTCGAGCAATAGGTCTTGTGTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178939.2-419s21c1
Sequence:CCGGTCAGCCCGGATGAGGTTAAAGCTCGAGCTTTAACCTCATCCGGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.2-301s1c1
Sequence:CCGGGATCAAGAGCACCTGGATAAACTCGAGTTTATCCAGGTGCTCTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.1-337s1c1
Sequence:CCGGCGGAGTCAACTTAAAGTGAAACTCGAGTTTCACTTTAAGTTGACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178939
VALIDATED
PDRG1 MISSION shRNA shRNA Plasmid DNA
p53 and DNA-damage regulated 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.1-273s1c1
Sequence:CCGGCCCTAAGACGAAGGAAATGATCTCGAGATCATTTCCTTCGTCTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.2-222s1c1
Sequence:CCGGCTCTGAAGATGTGATGGTTTGCTCGAGCAAACCATCACATCTTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178939.2-331s21c1
Sequence:CCGGAGGCTGCGGAGTCAACTTAAACTCGAGTTTAAGTTGACTCCGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178939.2-302s21c1
Sequence:CCGGATCAAGAGCACCTGGATAAAGCTCGAGCTTTATCCAGGTGCTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178939.2-353s21c1
Sequence:CCGGTGAAAGTTAACCGCCTCTTTGCTCGAGCAAAGAGGCGGTTAACTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178939.2-662s21c1
Sequence:CCGGGCTTGGACACAAGACCTATTGCTCGAGCAATAGGTCTTGTGTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178939.2-419s21c1
Sequence:CCGGTCAGCCCGGATGAGGTTAAAGCTCGAGCTTTAACCTCATCCGGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.2-301s1c1
Sequence:CCGGGATCAAGAGCACCTGGATAAACTCGAGTTTATCCAGGTGCTCTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.1-337s1c1
Sequence:CCGGCGGAGTCAACTTAAAGTGAAACTCGAGTTTCACTTTAAGTTGACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178939
VALIDATED
PDRG1 MISSION shRNA Lentiviral Transduction Particles
p53 and DNA-damage regulated 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.1-273s1c1
Sequence:CCGGCCCTAAGACGAAGGAAATGATCTCGAGATCATTTCCTTCGTCTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.2-222s1c1
Sequence:CCGGCTCTGAAGATGTGATGGTTTGCTCGAGCAAACCATCACATCTTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178939.2-331s21c1
Sequence:CCGGAGGCTGCGGAGTCAACTTAAACTCGAGTTTAAGTTGACTCCGCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178939.2-302s21c1
Sequence:CCGGATCAAGAGCACCTGGATAAAGCTCGAGCTTTATCCAGGTGCTCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178939.2-353s21c1
Sequence:CCGGTGAAAGTTAACCGCCTCTTTGCTCGAGCAAAGAGGCGGTTAACTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178939.2-662s21c1
Sequence:CCGGGCTTGGACACAAGACCTATTGCTCGAGCAATAGGTCTTGTGTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178939.2-419s21c1
Sequence:CCGGTCAGCCCGGATGAGGTTAAAGCTCGAGCTTTAACCTCATCCGGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.2-301s1c1
Sequence:CCGGGATCAAGAGCACCTGGATAAACTCGAGTTTATCCAGGTGCTCTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178939.1-337s1c1
Sequence:CCGGCGGAGTCAACTTAAAGTGAAACTCGAGTTTCACTTTAAGTTGACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)