EMAIL THIS PAGE TO A FRIEND

PDS5B

PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)

224 Gene Product Result for
Synonyms: APRIN AS3 CG008
Gene ID:
Human(23047) Summary: This gene encodes a protein that interacts with the conserved protein complex termed cohesion. The cohesion complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, May 2010]
Mouse(100710) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Rat(304218) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
cow(533890) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
sheep(101108926) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
domestic guinea pig(100714247) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Domestic Rabbit(100355583) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
naked mole-rat(101725183) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Zebrafish(565592) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
chicken(418910) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
dog(486014) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Horse(100062249) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
domestic cat(101082367) PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015032 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015032 Rosetta Predictions human pricing
NM_001101805 Rosetta Predictions rat pricing
NM_001102383 Rosetta Predictions rat pricing
NM_175310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086330 predicted 690
2 SASI_Hs01_00086331 predicted 1765
3 SASI_Hs01_00086332 predicted 2868
4 SASI_Hs01_00086333 predicted 1840
5 SASI_Hs02_00346843 predicted 2491
6 SASI_Hs01_00086334 predicted 2767
7 SASI_Hs01_00086335 predicted 1176
8 SASI_Hs01_00086336 predicted 655
9 SASI_Hs01_00086337 predicted 2447
10 SASI_Hs01_00086338 predicted 3425
11 SASI_Hs01_00086339 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211384 predicted 2552
2 SASI_Rn02_00211385 predicted 587
3 SASI_Rn02_00211386 predicted 401
4 SASI_Rn02_00211387 predicted 429
5 SASI_Rn02_00211388 predicted 289
6 SASI_Rn02_00211389 predicted 1041
7 SASI_Rn02_00211390 predicted 367
8 SASI_Rn02_00211391 predicted 1839
9 SASI_Rn02_00211392 predicted 1517
10 SASI_Rn02_00211393 predicted 4301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211424 predicted 2561
2 SASI_Rn02_00211425 predicted 590
3 SASI_Rn02_00211426 predicted 400
4 SASI_Rn02_00211427 predicted 427
5 SASI_Rn02_00211428 predicted 287
6 SASI_Rn02_00211429 predicted 1036
7 SASI_Rn02_00211430 predicted 361
8 SASI_Rn02_00211431 predicted 1834
9 SASI_Rn02_00211432 predicted 1519
10 SASI_Rn02_00211433 predicted 4414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114990 predicted 422
2 SASI_Mm01_00114991 predicted 1235
3 SASI_Mm01_00114992 predicted 823
4 SASI_Mm01_00114993 predicted 541
5 SASI_Mm01_00114994 predicted 564
6 SASI_Mm01_00114995 predicted 1520
7 SASI_Mm01_00114996 predicted 3011
8 SASI_Mm01_00114997 predicted 2410
9 SASI_Mm01_00114998 predicted 1281
10 SASI_Mm01_00114999 predicted 2695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175310
VALIDATED
PDS5B MISSION shRNA Bacterial Glycerol Stock
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-511s1c1
Sequence:CCGGGCCCTCAGTTTAATAGGTATTCTCGAGAATACCTATTAAACTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-444s1c1
Sequence:CCGGCCCGATAAACTAAAGGATATACTCGAGTATATCCTTTAGTTTATCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-1653s1c1
Sequence:CCGGCGACATCAAGTAAAGGATTTACTCGAGTAAATCCTTTACTTGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175310.3-822s1c1
Sequence:CCGGGCTCAAGCTATTGAACCATATCTCGAGATATGGTTCAATAGCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175310
VALIDATED
PDS5B MISSION shRNA shRNA Plasmid DNA
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-511s1c1
Sequence:CCGGGCCCTCAGTTTAATAGGTATTCTCGAGAATACCTATTAAACTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-444s1c1
Sequence:CCGGCCCGATAAACTAAAGGATATACTCGAGTATATCCTTTAGTTTATCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-1653s1c1
Sequence:CCGGCGACATCAAGTAAAGGATTTACTCGAGTAAATCCTTTACTTGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175310.3-822s1c1
Sequence:CCGGGCTCAAGCTATTGAACCATATCTCGAGATATGGTTCAATAGCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175310
VALIDATED
PDS5B MISSION shRNA Lentiviral Transduction Particles
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-511s1c1
Sequence:CCGGGCCCTCAGTTTAATAGGTATTCTCGAGAATACCTATTAAACTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-444s1c1
Sequence:CCGGCCCGATAAACTAAAGGATATACTCGAGTATATCCTTTAGTTTATCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175310.3-1653s1c1
Sequence:CCGGCGACATCAAGTAAAGGATTTACTCGAGTAAATCCTTTACTTGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175310.3-822s1c1
Sequence:CCGGGCTCAAGCTATTGAACCATATCTCGAGATATGGTTCAATAGCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015032
VALIDATED
PDS5B MISSION shRNA Bacterial Glycerol Stock
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-1959s1c1
Sequence:CCGGGCACATAGATACCGAATCTATCTCGAGATAGATTCGGTATCTATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_015032.1-226s1c1
Sequence:CCGGCGATTAAAGATGGTTGTGAAACTCGAGTTTCACAACCATCTTTAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-340s1c1
Sequence:CCGGCCTGATAAAGATGTTCGCTTACTCGAGTAAGCGAACATCTTTATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-1113s1c1
Sequence:CCGGCCGCCTGGAATGTGTGAAATTCTCGAGAATTTCACACATTCCAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_015032.1-3088s1c1
Sequence:CCGGCCAGAGTATGTTGTTCCATATCTCGAGATATGGAACAACATACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015032.2-5041s21c1
Sequence:CCGGTTACTCCTGGGCACCCTTAATCTCGAGATTAAGGGTGCCCAGGAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-693s21c1
Sequence:CCGGGACCTTATGAGCTCTATTATTCTCGAGAATAATAGAGCTCATAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-836s21c1
Sequence:CCGGTCAAGCTATTGAGCCATATATCTCGAGATATATGGCTCAATAGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-624s21c1
Sequence:CCGGCAGCTATACAGAACCTTATTTCTCGAGAAATAAGGTTCTGTATAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015032.2-1310s21c1
Sequence:CCGGGGTCAATGATCACTTACTTAACTCGAGTTAAGTAAGTGATCATTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015032
VALIDATED
PDS5B MISSION shRNA shRNA Plasmid DNA
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-1959s1c1
Sequence:CCGGGCACATAGATACCGAATCTATCTCGAGATAGATTCGGTATCTATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_015032.1-226s1c1
Sequence:CCGGCGATTAAAGATGGTTGTGAAACTCGAGTTTCACAACCATCTTTAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-340s1c1
Sequence:CCGGCCTGATAAAGATGTTCGCTTACTCGAGTAAGCGAACATCTTTATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-1113s1c1
Sequence:CCGGCCGCCTGGAATGTGTGAAATTCTCGAGAATTTCACACATTCCAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_015032.1-3088s1c1
Sequence:CCGGCCAGAGTATGTTGTTCCATATCTCGAGATATGGAACAACATACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015032.2-5041s21c1
Sequence:CCGGTTACTCCTGGGCACCCTTAATCTCGAGATTAAGGGTGCCCAGGAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-693s21c1
Sequence:CCGGGACCTTATGAGCTCTATTATTCTCGAGAATAATAGAGCTCATAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-836s21c1
Sequence:CCGGTCAAGCTATTGAGCCATATATCTCGAGATATATGGCTCAATAGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-624s21c1
Sequence:CCGGCAGCTATACAGAACCTTATTTCTCGAGAAATAAGGTTCTGTATAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015032.2-1310s21c1
Sequence:CCGGGGTCAATGATCACTTACTTAACTCGAGTTAAGTAAGTGATCATTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015032
VALIDATED
PDS5B MISSION shRNA Lentiviral Transduction Particles
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-1959s1c1
Sequence:CCGGGCACATAGATACCGAATCTATCTCGAGATAGATTCGGTATCTATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_015032.1-226s1c1
Sequence:CCGGCGATTAAAGATGGTTGTGAAACTCGAGTTTCACAACCATCTTTAATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-340s1c1
Sequence:CCGGCCTGATAAAGATGTTCGCTTACTCGAGTAAGCGAACATCTTTATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015032.1-1113s1c1
Sequence:CCGGCCGCCTGGAATGTGTGAAATTCTCGAGAATTTCACACATTCCAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_015032.1-3088s1c1
Sequence:CCGGCCAGAGTATGTTGTTCCATATCTCGAGATATGGAACAACATACTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015032.2-5041s21c1
Sequence:CCGGTTACTCCTGGGCACCCTTAATCTCGAGATTAAGGGTGCCCAGGAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-693s21c1
Sequence:CCGGGACCTTATGAGCTCTATTATTCTCGAGAATAATAGAGCTCATAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-836s21c1
Sequence:CCGGTCAAGCTATTGAGCCATATATCTCGAGATATATGGCTCAATAGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015032.2-624s21c1
Sequence:CCGGCAGCTATACAGAACCTTATTTCTCGAGAAATAAGGTTCTGTATAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015032.2-1310s21c1
Sequence:CCGGGGTCAATGATCACTTACTTAACTCGAGTTAAGTAAGTGATCATTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)