EMAIL THIS PAGE TO A FRIEND

PDX1

pancreatic and duodenal homeobox 1

52 Gene Product Result for
Synonyms: GSF IDX-1 IPF1 IUF1 MODY4 PDX-1 STF-1
UniProtKB ID: P52945, O60594, Q5VYW2
Gene ID:
Human(3651) Summary: The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (NIDDM), as well as maturity onset diabetes of the young type 4 (MODY4). [provided by RefSeq, Jul 2008]
Mouse(18609) pancreatic and duodenal homeobox 1
Rat(29535) pancreatic and duodenal homeobox 1
cow(538927) pancreatic and duodenal homeobox 1
sheep(100820739) pancreatic and duodenal homeobox 1
naked mole-rat(101715013) pancreatic and duodenal homeobox 1
domestic guinea pig(100731776) pancreatic and duodenal homeobox 1
Zebrafish(30721) pancreatic and duodenal homeobox 1
chicken(771348) pancreatic and duodenal homeobox 1
dog(493994) pancreatic and duodenal homeobox 1
domestic cat(100240682) pancreatic and duodenal homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1633 Human PDX-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046321 MISSION® esiRNA esiRNA targeting mouse Pdx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000209 Rosetta Predictions human pricing
NM_022852 Rosetta Predictions rat pricing
NM_008814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108076 predicted 1212
2 SASI_Hs01_00108080 predicted 1274
3 SASI_Hs02_00302091 predicted 1374
4 SASI_Hs01_00108074 predicted 1297
5 SASI_Hs02_00302092 predicted 1316
6 SASI_Hs02_00302093 predicted 1313
7 SASI_Hs02_00302094 predicted 1371
8 SASI_Hs02_00302095 predicted 668
9 SASI_Hs02_00302096 predicted 1333
10 SASI_Hs01_00108081 predicted 1305
11 SASI_Hs01_00108073 predicted 1275
12 SASI_Hs01_00108075 predicted 585
13 SASI_Hs01_00108077 predicted 583
14 SASI_Hs01_00108078 predicted 451
15 SASI_Hs01_00108079 predicted 1292
16 SASI_Hs01_00108082 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070510 predicted 516
2 SASI_Rn01_00070511 predicted 525
3 SASI_Rn02_00263566 predicted 574
4 SASI_Rn01_00070513 predicted 444
5 SASI_Rn01_00070514 predicted 648
6 SASI_Rn01_00070515 predicted 580
7 SASI_Rn01_00070516 predicted 470
8 SASI_Rn01_00070517 predicted 715
9 SASI_Rn01_00070518 predicted 388
10 SASI_Rn01_00070519 predicted 373
11 SASI_Rn01_00070512 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179942 predicted 901
2 SASI_Mm01_00179944 predicted 1019
3 SASI_Mm02_00314746 predicted 264
4 SASI_Mm02_00314747 predicted 596
5 SASI_Mm02_00314748 predicted 761
6 SASI_Mm01_00179945 predicted 383
7 SASI_Mm01_00179946 predicted 396
8 SASI_Mm01_00179947 predicted 882
9 SASI_Mm02_00314749 predicted 880
10 SASI_Mm01_00179949 predicted 590
11 SASI_Mm01_00179941 predicted 1182
12 SASI_Mm01_00179943 predicted 1180
13 SASI_Mm01_00179948 predicted 1161
14 SASI_Mm01_00179950 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000209
PDX1 MISSION shRNA Bacterial Glycerol Stock
pancreatic and duodenal homeobox 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-141s1c1
Sequence:CCGGCAAGGACCCATGCGCGTTCCACTCGAGTGGAACGCGCATGGGTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-651s1c1
Sequence:CCGGCTTGACCGAGAGACACATCAACTCGAGTTGATGTGTCTCTCGGTCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-462s1c1
Sequence:CCGGGATGAAGTCTACCAAAGCTCACTCGAGTGAGCTTTGGTAGACTTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000209.1-1368s1c1
Sequence:CCGGCGAGTACCTTAATCTGCCATACTCGAGTATGGCAGATTAAGGTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-591s1c1
Sequence:CCGGGTTCCTATTCAACAAGTACATCTCGAGATGTACTTGTTGAATAGGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000209.3-641s21c1
Sequence:CCGGAGCTGGCTGTCATGTTGAACTCTCGAGAGTTCAACATGACAGCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000209.3-1299s21c1
Sequence:CCGGGCCGGCTCTTCAAAGACAATGCTCGAGCATTGTCTTTGAAGAGCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000209
PDX1 MISSION shRNA shRNA Plasmid DNA
pancreatic and duodenal homeobox 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-141s1c1
Sequence:CCGGCAAGGACCCATGCGCGTTCCACTCGAGTGGAACGCGCATGGGTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-651s1c1
Sequence:CCGGCTTGACCGAGAGACACATCAACTCGAGTTGATGTGTCTCTCGGTCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-462s1c1
Sequence:CCGGGATGAAGTCTACCAAAGCTCACTCGAGTGAGCTTTGGTAGACTTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000209.1-1368s1c1
Sequence:CCGGCGAGTACCTTAATCTGCCATACTCGAGTATGGCAGATTAAGGTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-591s1c1
Sequence:CCGGGTTCCTATTCAACAAGTACATCTCGAGATGTACTTGTTGAATAGGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000209.3-641s21c1
Sequence:CCGGAGCTGGCTGTCATGTTGAACTCTCGAGAGTTCAACATGACAGCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000209.3-1299s21c1
Sequence:CCGGGCCGGCTCTTCAAAGACAATGCTCGAGCATTGTCTTTGAAGAGCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000209
PDX1 MISSION shRNA Lentiviral Transduction Particles
pancreatic and duodenal homeobox 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-141s1c1
Sequence:CCGGCAAGGACCCATGCGCGTTCCACTCGAGTGGAACGCGCATGGGTCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-651s1c1
Sequence:CCGGCTTGACCGAGAGACACATCAACTCGAGTTGATGTGTCTCTCGGTCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-462s1c1
Sequence:CCGGGATGAAGTCTACCAAAGCTCACTCGAGTGAGCTTTGGTAGACTTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000209.1-1368s1c1
Sequence:CCGGCGAGTACCTTAATCTGCCATACTCGAGTATGGCAGATTAAGGTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000209.1-591s1c1
Sequence:CCGGGTTCCTATTCAACAAGTACATCTCGAGATGTACTTGTTGAATAGGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000209.3-641s21c1
Sequence:CCGGAGCTGGCTGTCATGTTGAACTCTCGAGAGTTCAACATGACAGCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000209.3-1299s21c1
Sequence:CCGGGCCGGCTCTTCAAAGACAATGCTCGAGCATTGTCTTTGAAGAGCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008814
PDX1 MISSION shRNA Bacterial Glycerol Stock
pancreatic and duodenal homeobox 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-473s1c1
Sequence:CCGGCCCGTGGATGAAATCCACCAACTCGAGTTGGTGGATTTCATCCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008814.2-1510s1c1
Sequence:CCGGCCTATACCATTTCCTTTGAAACTCGAGTTTCAAAGGAAATGGTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-727s1c1
Sequence:CCGGAGGAAGATAAGAAACGTAGTACTCGAGTACTACGTTTCTTATCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-784s1c1
Sequence:CCGGCGGAGCAAGATTGTGCGGTGACTCGAGTCACCGCACAATCTTGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-259s1c1
Sequence:CCGGAGTTTACAAGCTCGCTGGGATCTCGAGATCCCAGCGAGCTTGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-724s21c1
Sequence:GTACCGGGAAGATAAGAAACGTAGTAGCCTCGAGGCTACTACGTTTCTTATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-664s21c1
Sequence:CCGGTTGACCGAGAGACACATCAAACTCGAGTTTGATGTGTCTCTCGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008814.3-1077s21c1
Sequence:CCGGACGAGAGCCAGTTGGGTATAGCTCGAGCTATACCCAACTGGCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-461s21c1
Sequence:CCGGTCCCTTTCCCGTGGATGAAATCTCGAGATTTCATCCACGGGAAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-484s21c1
Sequence:CCGGACCAAAGCTCACGCGTGGAAACTCGAGTTTCCACGCGTGAGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008814
PDX1 MISSION shRNA shRNA Plasmid DNA
pancreatic and duodenal homeobox 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-473s1c1
Sequence:CCGGCCCGTGGATGAAATCCACCAACTCGAGTTGGTGGATTTCATCCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008814.2-1510s1c1
Sequence:CCGGCCTATACCATTTCCTTTGAAACTCGAGTTTCAAAGGAAATGGTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-727s1c1
Sequence:CCGGAGGAAGATAAGAAACGTAGTACTCGAGTACTACGTTTCTTATCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-784s1c1
Sequence:CCGGCGGAGCAAGATTGTGCGGTGACTCGAGTCACCGCACAATCTTGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-259s1c1
Sequence:CCGGAGTTTACAAGCTCGCTGGGATCTCGAGATCCCAGCGAGCTTGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-724s21c1
Sequence:GTACCGGGAAGATAAGAAACGTAGTAGCCTCGAGGCTACTACGTTTCTTATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-664s21c1
Sequence:CCGGTTGACCGAGAGACACATCAAACTCGAGTTTGATGTGTCTCTCGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008814.3-1077s21c1
Sequence:CCGGACGAGAGCCAGTTGGGTATAGCTCGAGCTATACCCAACTGGCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-461s21c1
Sequence:CCGGTCCCTTTCCCGTGGATGAAATCTCGAGATTTCATCCACGGGAAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-484s21c1
Sequence:CCGGACCAAAGCTCACGCGTGGAAACTCGAGTTTCCACGCGTGAGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008814
PDX1 MISSION shRNA Lentiviral Transduction Particles
pancreatic and duodenal homeobox 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-473s1c1
Sequence:CCGGCCCGTGGATGAAATCCACCAACTCGAGTTGGTGGATTTCATCCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008814.2-1510s1c1
Sequence:CCGGCCTATACCATTTCCTTTGAAACTCGAGTTTCAAAGGAAATGGTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-727s1c1
Sequence:CCGGAGGAAGATAAGAAACGTAGTACTCGAGTACTACGTTTCTTATCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-784s1c1
Sequence:CCGGCGGAGCAAGATTGTGCGGTGACTCGAGTCACCGCACAATCTTGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008814.2-259s1c1
Sequence:CCGGAGTTTACAAGCTCGCTGGGATCTCGAGATCCCAGCGAGCTTGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-724s21c1
Sequence:GTACCGGGAAGATAAGAAACGTAGTAGCCTCGAGGCTACTACGTTTCTTATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-664s21c1
Sequence:CCGGTTGACCGAGAGACACATCAAACTCGAGTTTGATGTGTCTCTCGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008814.3-1077s21c1
Sequence:CCGGACGAGAGCCAGTTGGGTATAGCTCGAGCTATACCCAACTGGCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-461s21c1
Sequence:CCGGTCCCTTTCCCGTGGATGAAATCTCGAGATTTCATCCACGGGAAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008814.3-484s21c1
Sequence:CCGGACCAAAGCTCACGCGTGGAAACTCGAGTTTCCACGCGTGAGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)