EMAIL THIS PAGE TO A FRIEND

PDZD11

PDZ domain containing 11

94 Gene Product Result for
Synonyms: AIPP1 PDZK11 PISP
UniProtKB ID: Q5EBL8, D3DVU3, Q6UWE1, Q9P0Q1
Gene ID:
Mouse(72621) PDZ domain containing 11
Rat(302422) PDZ domain containing 11
Zebrafish(405893) PDZ domain containing 11
domestic cat(101088144) PDZ domain containing 11
dog(491940) PDZ domain containing 11
chicken(422153) PDZ domain containing 11
cow(515371) PDZ domain containing 11
sheep(101122923) PDZ domain containing 11
domestic guinea pig(100733136) PDZ domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016484 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016484 Rosetta Predictions human pricing
NM_001106945 Rosetta Predictions rat pricing
NM_028303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167816 predicted 653
2 SASI_Hs02_00349542 predicted 708
3 SASI_Hs01_00167817 predicted 484
4 SASI_Hs01_00167818 predicted 728
5 SASI_Hs01_00167819 predicted 392
6 SASI_Hs01_00167820 predicted 340
7 SASI_Hs02_00349543 predicted 376
8 SASI_Hs02_00349544 predicted 732
9 SASI_Hs01_00167821 predicted 323
10 SASI_Hs01_00167822 predicted 723
11 SASI_Hs01_00167823 predicted 805
12 SASI_Hs01_00167824 predicted 554
13 SASI_Hs01_00167825 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223956 predicted 299
2 SASI_Rn02_00223957 predicted 758
3 SASI_Rn02_00223958 predicted 576
4 SASI_Rn02_00223959 predicted 685
5 SASI_Rn02_00223960 predicted 333
6 SASI_Rn02_00223961 predicted 903
7 SASI_Rn02_00223962 predicted 283
8 SASI_Rn02_00223963 predicted 798
9 SASI_Rn02_00223964 predicted 744
10 SASI_Rn02_00223965 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141404 predicted 595
2 SASI_Mm01_00141405 predicted 422
3 SASI_Mm01_00141406 predicted 387
4 SASI_Mm01_00141407 predicted 479
5 SASI_Mm01_00141408 predicted 376
6 SASI_Mm01_00141409 predicted 479
7 SASI_Mm01_00141410 predicted 202
8 SASI_Mm01_00141411 predicted 592
9 SASI_Mm01_00141412 predicted 369
10 SASI_Mm01_00141413 predicted 449
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028303
VALIDATED
PDZD11 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-390s21c1
Sequence:CCGGAGCTGTGAATGATGTGGATTTCTCGAGAAATCCACATCATTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-476s21c1
Sequence:CCGGTGCGCTTCTTTCCCTACAATTCTCGAGAATTGTAGGGAAAGAAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-267s21c1
Sequence:CCGGTGGTGCTCAGTTGGGATTTAACTCGAGTTAAATCCCAACTGAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028303.3-703s21c1
Sequence:CCGGCCTAGTTTGCTAGGTGAGTTTCTCGAGAAACTCACCTAGCAAACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-201s21c1
Sequence:CCGGCCACCCAGACTACAACAATGACTCGAGTCATTGTTGTAGTCTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028303.1-704s1c1
Sequence:CCGGCCTAGTTTGCTAGGTGAGTTTCTCGAGAAACTCACCTAGCAAACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028303.1-241s1c1
Sequence:CCGGCCGAATTGTTACACTGAAGAACTCGAGTTCTTCAGTGTAACAATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028303.1-202s1c1
Sequence:CCGGCCACCCAGACTACAACAATGACTCGAGTCATTGTTGTAGTCTGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028303.1-413s1c1
Sequence:CCGGCAAGATATTGAGCACAGCAAACTCGAGTTTGCTGTGCTCAATATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028303
VALIDATED
PDZD11 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-390s21c1
Sequence:CCGGAGCTGTGAATGATGTGGATTTCTCGAGAAATCCACATCATTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-476s21c1
Sequence:CCGGTGCGCTTCTTTCCCTACAATTCTCGAGAATTGTAGGGAAAGAAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-267s21c1
Sequence:CCGGTGGTGCTCAGTTGGGATTTAACTCGAGTTAAATCCCAACTGAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028303.3-703s21c1
Sequence:CCGGCCTAGTTTGCTAGGTGAGTTTCTCGAGAAACTCACCTAGCAAACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-201s21c1
Sequence:CCGGCCACCCAGACTACAACAATGACTCGAGTCATTGTTGTAGTCTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028303.1-704s1c1
Sequence:CCGGCCTAGTTTGCTAGGTGAGTTTCTCGAGAAACTCACCTAGCAAACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028303.1-241s1c1
Sequence:CCGGCCGAATTGTTACACTGAAGAACTCGAGTTCTTCAGTGTAACAATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028303.1-202s1c1
Sequence:CCGGCCACCCAGACTACAACAATGACTCGAGTCATTGTTGTAGTCTGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028303.1-413s1c1
Sequence:CCGGCAAGATATTGAGCACAGCAAACTCGAGTTTGCTGTGCTCAATATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028303
VALIDATED
PDZD11 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-390s21c1
Sequence:CCGGAGCTGTGAATGATGTGGATTTCTCGAGAAATCCACATCATTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-476s21c1
Sequence:CCGGTGCGCTTCTTTCCCTACAATTCTCGAGAATTGTAGGGAAAGAAGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-267s21c1
Sequence:CCGGTGGTGCTCAGTTGGGATTTAACTCGAGTTAAATCCCAACTGAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028303.3-703s21c1
Sequence:CCGGCCTAGTTTGCTAGGTGAGTTTCTCGAGAAACTCACCTAGCAAACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028303.3-201s21c1
Sequence:CCGGCCACCCAGACTACAACAATGACTCGAGTCATTGTTGTAGTCTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028303.1-704s1c1
Sequence:CCGGCCTAGTTTGCTAGGTGAGTTTCTCGAGAAACTCACCTAGCAAACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028303.1-241s1c1
Sequence:CCGGCCGAATTGTTACACTGAAGAACTCGAGTTCTTCAGTGTAACAATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028303.1-202s1c1
Sequence:CCGGCCACCCAGACTACAACAATGACTCGAGTCATTGTTGTAGTCTGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028303.1-413s1c1
Sequence:CCGGCAAGATATTGAGCACAGCAAACTCGAGTTTGCTGTGCTCAATATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016484
VALIDATED
PDZD11 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-450s1c1
Sequence:CCGGGACCAAGTTCTAGCTGTGAATCTCGAGATTCACAGCTAGAACTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-311s1c1
Sequence:CCGGCCGAACCATCACACTGAAGAACTCGAGTTCTTCAGTGTGATGGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-352s1c1
Sequence:CCGGGATTTAACATCCGAGGAGGAACTCGAGTTCCTCCTCGGATGTTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-226s1c1
Sequence:CCGGCCTATGAGAATCCTCCAGCATCTCGAGATGCTGGAGGATTCTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-284s1c1
Sequence:CCGGCAACAATGAGTTGACCCAGTTCTCGAGAACTGGGTCAACTCATTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016484.3-1223s1c1
Sequence:CCGGCCAGAACATTAGCAAGGCCAACTCGAGTTGGCCTTGCTAATGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-788s1c1
Sequence:CCGGCCCTGAAAGGAGGATGATGATCTCGAGATCATCATCCTCCTTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-515s1c1
Sequence:CCGGCCTGAAGACAGCTCGTGAAATCTCGAGATTTCACGAGCTGTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-500s1c1
Sequence:CCGGCAAGGCTGTTGAGATCCTGAACTCGAGTTCAGGATCTCAACAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-275s1c1
Sequence:CCGGCCCGGACTACAACAATGAGTTCTCGAGAACTCATTGTTGTAGTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016484
VALIDATED
PDZD11 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-450s1c1
Sequence:CCGGGACCAAGTTCTAGCTGTGAATCTCGAGATTCACAGCTAGAACTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-311s1c1
Sequence:CCGGCCGAACCATCACACTGAAGAACTCGAGTTCTTCAGTGTGATGGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-352s1c1
Sequence:CCGGGATTTAACATCCGAGGAGGAACTCGAGTTCCTCCTCGGATGTTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-226s1c1
Sequence:CCGGCCTATGAGAATCCTCCAGCATCTCGAGATGCTGGAGGATTCTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-284s1c1
Sequence:CCGGCAACAATGAGTTGACCCAGTTCTCGAGAACTGGGTCAACTCATTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016484.3-1223s1c1
Sequence:CCGGCCAGAACATTAGCAAGGCCAACTCGAGTTGGCCTTGCTAATGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-788s1c1
Sequence:CCGGCCCTGAAAGGAGGATGATGATCTCGAGATCATCATCCTCCTTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-515s1c1
Sequence:CCGGCCTGAAGACAGCTCGTGAAATCTCGAGATTTCACGAGCTGTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-500s1c1
Sequence:CCGGCAAGGCTGTTGAGATCCTGAACTCGAGTTCAGGATCTCAACAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-275s1c1
Sequence:CCGGCCCGGACTACAACAATGAGTTCTCGAGAACTCATTGTTGTAGTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016484
VALIDATED
PDZD11 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-450s1c1
Sequence:CCGGGACCAAGTTCTAGCTGTGAATCTCGAGATTCACAGCTAGAACTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-311s1c1
Sequence:CCGGCCGAACCATCACACTGAAGAACTCGAGTTCTTCAGTGTGATGGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-352s1c1
Sequence:CCGGGATTTAACATCCGAGGAGGAACTCGAGTTCCTCCTCGGATGTTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-226s1c1
Sequence:CCGGCCTATGAGAATCCTCCAGCATCTCGAGATGCTGGAGGATTCTCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-284s1c1
Sequence:CCGGCAACAATGAGTTGACCCAGTTCTCGAGAACTGGGTCAACTCATTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016484.3-1223s1c1
Sequence:CCGGCCAGAACATTAGCAAGGCCAACTCGAGTTGGCCTTGCTAATGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-788s1c1
Sequence:CCGGCCCTGAAAGGAGGATGATGATCTCGAGATCATCATCCTCCTTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016484.3-515s1c1
Sequence:CCGGCCTGAAGACAGCTCGTGAAATCTCGAGATTTCACGAGCTGTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-500s1c1
Sequence:CCGGCAAGGCTGTTGAGATCCTGAACTCGAGTTCAGGATCTCAACAGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016484.3-275s1c1
Sequence:CCGGCCCGGACTACAACAATGAGTTCTCGAGAACTCATTGTTGTAGTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)