EMAIL THIS PAGE TO A FRIEND

PDZD3

PDZ domain containing 3

70 Gene Product Result for
Synonyms: IKEPP NHERF4 PDZK2
UniProtKB ID: Q86UT5, Q8N6R4, Q8NAW7, Q8NEX7, Q9H5Z3
Gene ID:
Human(79849) Summary: Guanylyl cyclase C (GCC, or GUCY2C; MIM 601330) produces cGMP following the binding of either endogenous ligands or heat-stable enterotoxins secreted by E. coli and other enteric bacteria. Activation of GCC initiates a signaling cascade that leads to phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR; MIM 602421), followed by a net efflux of ions and water into the intestinal lumen. IKEPP is a regulatory protein that associates with GCC and regulates the amount of cGMP produced following receptor stimulation (Scott et al., 2002 [PubMed 11950846]
Mouse(170761) PDZ domain containing 3
Rat(500986) PDZ domain containing 3
chicken(769876) PDZ domain containing 3
dog(610585) PDZ domain containing 3
Horse(100071387) PDZ domain containing 3
domestic cat(101084649) PDZ domain containing 3
cow(539171) PDZ domain containing 3
sheep(101108682) PDZ domain containing 3
Domestic Rabbit(100342091) PDZ domain containing 3
naked mole-rat(101707271) PDZ domain containing 3
domestic guinea pig(100718781) PDZ domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024791 Rosetta Predictions human pricing
XM_001066511 Rosetta Predictions rat pricing
XM_576397 Rosetta Predictions rat pricing
NM_133226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105704 predicted 281
2 SASI_Hs02_00357341 predicted 1699
3 SASI_Hs01_00105705 predicted 361
4 SASI_Hs01_00105707 predicted 1114
5 SASI_Hs01_00105708 predicted 1810
6 SASI_Hs01_00105709 predicted 1107
7 SASI_Hs01_00105710 predicted 1899
8 SASI_Hs01_00105711 predicted 1194
9 SASI_Hs01_00105712 predicted 1556
10 SASI_Hs01_00105713 predicted 296
11 SASI_Hs01_00105706 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317737 predicted 889
2 SASI_Rn02_00317738 predicted 1520
3 SASI_Rn02_00317739 predicted 1479
4 SASI_Rn02_00317740 predicted 1790
5 SASI_Rn02_00317741 predicted 281
6 SASI_Rn02_00317742 predicted 360
7 SASI_Rn02_00317743 predicted 648
8 SASI_Rn02_00317744 predicted 965
9 SASI_Rn02_00317745 predicted 1564
10 SASI_Rn02_00317746 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405241 predicted 893
2 SASI_Rn02_00405242 predicted 1516
3 SASI_Rn02_00405243 predicted 1480
4 SASI_Rn02_00405244 predicted 1784
5 SASI_Rn02_00405245 predicted 276
6 SASI_Rn02_00405246 predicted 359
7 SASI_Rn02_00405247 predicted 648
8 SASI_Rn02_00405248 predicted 965
9 SASI_Rn02_00405249 predicted 1571
10 SASI_Rn02_00405250 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117471 predicted 807
2 SASI_Mm01_00117472 predicted 1335
3 SASI_Mm01_00117473 predicted 1342
4 SASI_Mm01_00117474 predicted 1010
5 SASI_Mm01_00117475 predicted 368
6 SASI_Mm01_00117476 predicted 1531
7 SASI_Mm01_00117477 predicted 537
8 SASI_Mm01_00117478 predicted 1426
9 SASI_Mm02_00338458 predicted 1481
10 SASI_Mm01_00117479 predicted 382
11 SASI_Mm01_00117480 predicted 1353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024791
PDZD3 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-1289s21c1
Sequence:CCGGTGCAAGTGGGAGACGTGATTCCTCGAGGAATCACGTCTCCCACTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-42s21c1
Sequence:CCGGCTCGTTAACTCTGAAGTTTAACTCGAGTTAAACTTCAGAGTTAACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-41s1c1
Sequence:CCGGCCTCGTTAACTCTGAAGTTTACTCGAGTAAACTTCAGAGTTAACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-301s1c1
Sequence:CCGGGTGAACAATGATGTTGTGGAACTCGAGTTCCACAACATCATTGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024791.2-1895s21c1
Sequence:CCGGTGCTTGGTCACCGTTGCATTTCTCGAGAAATGCAACGGTGACCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-541s1c1
Sequence:CCGGCCTTTCTGGTTGGTGCTAAGTCTCGAGACTTAGCACCAACCAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-369s21c1
Sequence:CCGGTCGGGTGTTGCTGACAGTATTCTCGAGAATACTGTCAGCAACACCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-69s21c1
Sequence:CCGGCCCAAAGCTGGGCATTGATAACTCGAGTTATCAATGCCCAGCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024791
PDZD3 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-1289s21c1
Sequence:CCGGTGCAAGTGGGAGACGTGATTCCTCGAGGAATCACGTCTCCCACTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-42s21c1
Sequence:CCGGCTCGTTAACTCTGAAGTTTAACTCGAGTTAAACTTCAGAGTTAACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-41s1c1
Sequence:CCGGCCTCGTTAACTCTGAAGTTTACTCGAGTAAACTTCAGAGTTAACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-301s1c1
Sequence:CCGGGTGAACAATGATGTTGTGGAACTCGAGTTCCACAACATCATTGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024791.2-1895s21c1
Sequence:CCGGTGCTTGGTCACCGTTGCATTTCTCGAGAAATGCAACGGTGACCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-541s1c1
Sequence:CCGGCCTTTCTGGTTGGTGCTAAGTCTCGAGACTTAGCACCAACCAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-369s21c1
Sequence:CCGGTCGGGTGTTGCTGACAGTATTCTCGAGAATACTGTCAGCAACACCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-69s21c1
Sequence:CCGGCCCAAAGCTGGGCATTGATAACTCGAGTTATCAATGCCCAGCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024791
PDZD3 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-1289s21c1
Sequence:CCGGTGCAAGTGGGAGACGTGATTCCTCGAGGAATCACGTCTCCCACTTGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-42s21c1
Sequence:CCGGCTCGTTAACTCTGAAGTTTAACTCGAGTTAAACTTCAGAGTTAACGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000147190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-41s1c1
Sequence:CCGGCCTCGTTAACTCTGAAGTTTACTCGAGTAAACTTCAGAGTTAACGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000147413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-301s1c1
Sequence:CCGGGTGAACAATGATGTTGTGGAACTCGAGTTCCACAACATCATTGTTCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024791.2-1895s21c1
Sequence:CCGGTGCTTGGTCACCGTTGCATTTCTCGAGAAATGCAACGGTGACCAAGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024791.2-541s1c1
Sequence:CCGGCCTTTCTGGTTGGTGCTAAGTCTCGAGACTTAGCACCAACCAGAAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-369s21c1
Sequence:CCGGTCGGGTGTTGCTGACAGTATTCTCGAGAATACTGTCAGCAACACCCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000245421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024791.2-69s21c1
Sequence:CCGGCCCAAAGCTGGGCATTGATAACTCGAGTTATCAATGCCCAGCTTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133226
PDZD3 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-635s1c1
Sequence:CCGGGCTCACATACAACCAGCTCAACTCGAGTTGAGCTGGTTGTATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-636s1c1
Sequence:CCGGCTCACATACAACCAGCTCAATCTCGAGATTGAGCTGGTTGTATGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-36s1c1
Sequence:CCGGGCCTTGTTAACTCTGAAGTTTCTCGAGAAACTTCAGAGTTAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133226.1-1908s1c1
Sequence:CCGGCCTTCTACTGTGGATACCTTACTCGAGTAAGGTATCCACAGTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-788s1c1
Sequence:CCGGCCGATGTCTAAACATAGAGAACTCGAGTTCTCTATGTTTAGACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133226
PDZD3 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-635s1c1
Sequence:CCGGGCTCACATACAACCAGCTCAACTCGAGTTGAGCTGGTTGTATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-636s1c1
Sequence:CCGGCTCACATACAACCAGCTCAATCTCGAGATTGAGCTGGTTGTATGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-36s1c1
Sequence:CCGGGCCTTGTTAACTCTGAAGTTTCTCGAGAAACTTCAGAGTTAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133226.1-1908s1c1
Sequence:CCGGCCTTCTACTGTGGATACCTTACTCGAGTAAGGTATCCACAGTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-788s1c1
Sequence:CCGGCCGATGTCTAAACATAGAGAACTCGAGTTCTCTATGTTTAGACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133226
PDZD3 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-635s1c1
Sequence:CCGGGCTCACATACAACCAGCTCAACTCGAGTTGAGCTGGTTGTATGTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-636s1c1
Sequence:CCGGCTCACATACAACCAGCTCAATCTCGAGATTGAGCTGGTTGTATGTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-36s1c1
Sequence:CCGGGCCTTGTTAACTCTGAAGTTTCTCGAGAAACTTCAGAGTTAACAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133226.1-1908s1c1
Sequence:CCGGCCTTCTACTGTGGATACCTTACTCGAGTAAGGTATCCACAGTAGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000105389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133226.1-788s1c1
Sequence:CCGGCCGATGTCTAAACATAGAGAACTCGAGTTCTCTATGTTTAGACATCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???