EMAIL THIS PAGE TO A FRIEND

PDZD4

PDZ domain containing 4

80 Gene Product Result for
Synonyms: LU1 PDZK4 PDZRN4L
UniProtKB ID: Q76G19, B3KXB1, Q8NB75, Q9BUH9, Q9P284
Gene ID:
Mouse(245469) PDZ domain containing 4
Rat(293856) PDZ domain containing 4
Zebrafish(553320) PDZ domain containing 4
domestic cat(101081710) PDZ domain containing 4
Horse(100057848) PDZ domain containing 4
dog(610856) PDZ domain containing 4
domestic guinea pig(100726704) PDZ domain containing 4
naked mole-rat(101722812) PDZ domain containing 4
Domestic Rabbit(100328745) PDZ domain containing 4
cow(538475) PDZ domain containing 4
sheep(101122174) PDZ domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032512 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154491 MISSION® esiRNA esiRNA targeting mouse Pdzd4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032512 Rosetta Predictions human pricing
XM_001057431 Rosetta Predictions rat pricing
XM_219716 Rosetta Predictions rat pricing
NM_001029868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029690 predicted 2382
2 SASI_Hs01_00029691 predicted 1476
3 SASI_Hs01_00029692 predicted 884
4 SASI_Hs01_00029694 predicted 1490
5 SASI_Hs01_00029695 predicted 1356
6 SASI_Hs01_00029696 predicted 2168
7 SASI_Hs02_00360006 predicted 1456
8 SASI_Hs01_00029697 predicted 1221
9 SASI_Hs01_00029698 predicted 1096
10 SASI_Hs01_00029699 predicted 750
11 SASI_Hs01_00029693 predicted 1458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286309 predicted 560
2 SASI_Rn02_00286310 predicted 481
3 SASI_Rn02_00286311 predicted 499
4 SASI_Rn02_00286312 predicted 1239
5 SASI_Rn02_00286313 predicted 676
6 SASI_Rn02_00286314 predicted 444
7 SASI_Rn02_00286315 predicted 548
8 SASI_Rn02_00286316 predicted 1253
9 SASI_Rn02_00286317 predicted 736
10 SASI_Rn02_00286318 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378639 predicted 545
2 SASI_Rn02_00378640 predicted 1578
3 SASI_Rn02_00378641 predicted 1218
4 SASI_Rn02_00378642 predicted 658
5 SASI_Rn02_00378643 predicted 532
6 SASI_Rn02_00378644 predicted 1233
7 SASI_Rn02_00378645 predicted 714
8 SASI_Rn02_00378646 predicted 698
9 SASI_Rn02_00378647 predicted 983
10 SASI_Rn02_00378648 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137409 predicted 1883
2 SASI_Mm01_00137411 predicted 1188
3 SASI_Mm01_00137412 predicted 1114
4 SASI_Mm01_00137413 predicted 1122
5 SASI_Mm01_00137414 predicted 1310
6 SASI_Mm01_00137415 predicted 2814
7 SASI_Mm02_00288040 predicted 2020
8 SASI_Mm01_00137416 predicted 2824
9 SASI_Mm01_00137417 predicted 2603
10 SASI_Mm01_00137418 predicted 1890
11 SASI_Mm01_00137410 predicted 1732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032512
PDZD4 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-551s21c1
Sequence:CCGGCCAATCAGCCATGAGTATTATCTCGAGATAATACTCATGGCTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-802s21c1
Sequence:CCGGTAACGGTGTAGACGTCCAGAACTCGAGTTCTGGACGTCTACACCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-1480s21c1
Sequence:CCGGATTCAAGTGCCGCAACATACTCTCGAGAGTATGTTGCGGCACTTGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032512.2-3058s1c1
Sequence:CCGGCCCTTTCTGTGCTTGCCAATACTCGAGTATTGGCAAGCACAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-932s1c1
Sequence:CCGGGATGACTTCCTGGATGACTTTCTCGAGAAAGTCATCCAGGAAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-944s1c1
Sequence:CCGGGATGACTTTGGCTCTGAGAATCTCGAGATTCTCAGAGCCAAAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-734s1c1
Sequence:CCGGGAGGTAAATCCCAACAGCATTCTCGAGAATGCTGTTGGGATTTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-720s1c1
Sequence:CCGGGCATTTATGTCGGAGAGGTAACTCGAGTTACCTCTCCGACATAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032512.2-3010s1c1
Sequence:CCGGCTGCAGTTATTTGTAGACAAACTCGAGTTTGTCTACAAATAACTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032512
PDZD4 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-551s21c1
Sequence:CCGGCCAATCAGCCATGAGTATTATCTCGAGATAATACTCATGGCTGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-802s21c1
Sequence:CCGGTAACGGTGTAGACGTCCAGAACTCGAGTTCTGGACGTCTACACCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-1480s21c1
Sequence:CCGGATTCAAGTGCCGCAACATACTCTCGAGAGTATGTTGCGGCACTTGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032512.2-3058s1c1
Sequence:CCGGCCCTTTCTGTGCTTGCCAATACTCGAGTATTGGCAAGCACAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-932s1c1
Sequence:CCGGGATGACTTCCTGGATGACTTTCTCGAGAAAGTCATCCAGGAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-944s1c1
Sequence:CCGGGATGACTTTGGCTCTGAGAATCTCGAGATTCTCAGAGCCAAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-734s1c1
Sequence:CCGGGAGGTAAATCCCAACAGCATTCTCGAGAATGCTGTTGGGATTTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-720s1c1
Sequence:CCGGGCATTTATGTCGGAGAGGTAACTCGAGTTACCTCTCCGACATAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032512.2-3010s1c1
Sequence:CCGGCTGCAGTTATTTGTAGACAAACTCGAGTTTGTCTACAAATAACTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032512
PDZD4 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-551s21c1
Sequence:CCGGCCAATCAGCCATGAGTATTATCTCGAGATAATACTCATGGCTGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-802s21c1
Sequence:CCGGTAACGGTGTAGACGTCCAGAACTCGAGTTCTGGACGTCTACACCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032512.2-1480s21c1
Sequence:CCGGATTCAAGTGCCGCAACATACTCTCGAGAGTATGTTGCGGCACTTGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032512.2-3058s1c1
Sequence:CCGGCCCTTTCTGTGCTTGCCAATACTCGAGTATTGGCAAGCACAGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-932s1c1
Sequence:CCGGGATGACTTCCTGGATGACTTTCTCGAGAAAGTCATCCAGGAAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-944s1c1
Sequence:CCGGGATGACTTTGGCTCTGAGAATCTCGAGATTCTCAGAGCCAAAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-734s1c1
Sequence:CCGGGAGGTAAATCCCAACAGCATTCTCGAGAATGCTGTTGGGATTTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032512.2-720s1c1
Sequence:CCGGGCATTTATGTCGGAGAGGTAACTCGAGTTACCTCTCCGACATAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032512.2-3010s1c1
Sequence:CCGGCTGCAGTTATTTGTAGACAAACTCGAGTTTGTCTACAAATAACTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029868
PDZD4 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029868.1-3327s1c1
Sequence:CCGGGCTGCAATTATTTGTAGACAACTCGAGTTGTCTACAAATAATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1116s1c1
Sequence:CCGGGCATCTACGTTGGAGAGGTAACTCGAGTTACCTCTCCAACGTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1868s1c1
Sequence:CCGGCTAGAGTTCAAGTGCCGCAATCTCGAGATTGCGGCACTTGAACTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1369s1c1
Sequence:CCGGCCTTCGTGCTAGGAAGCTAAACTCGAGTTTAGCTTCCTAGCACGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029868
PDZD4 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029868.1-3327s1c1
Sequence:CCGGGCTGCAATTATTTGTAGACAACTCGAGTTGTCTACAAATAATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1116s1c1
Sequence:CCGGGCATCTACGTTGGAGAGGTAACTCGAGTTACCTCTCCAACGTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1868s1c1
Sequence:CCGGCTAGAGTTCAAGTGCCGCAATCTCGAGATTGCGGCACTTGAACTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1369s1c1
Sequence:CCGGCCTTCGTGCTAGGAAGCTAAACTCGAGTTTAGCTTCCTAGCACGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029868
PDZD4 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029868.1-3327s1c1
Sequence:CCGGGCTGCAATTATTTGTAGACAACTCGAGTTGTCTACAAATAATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1116s1c1
Sequence:CCGGGCATCTACGTTGGAGAGGTAACTCGAGTTACCTCTCCAACGTAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1868s1c1
Sequence:CCGGCTAGAGTTCAAGTGCCGCAATCTCGAGATTGCGGCACTTGAACTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029868.1-1369s1c1
Sequence:CCGGCCTTCGTGCTAGGAAGCTAAACTCGAGTTTAGCTTCCTAGCACGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)