EMAIL THIS PAGE TO A FRIEND

PDZD7

PDZ domain containing 7

29 Gene Product Result for
Synonyms: PDZK7
UniProtKB ID: Q9H5P4, D5FJ77, Q8N321
Gene ID:
Human(79955) Summary: This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(100503041) PDZ domain containing 7
Rat(293996) PDZ domain containing 7
sheep(101112437) PDZ domain containing 7
naked mole-rat(101720971) PDZ domain containing 7
domestic guinea pig(100723013) PDZ domain containing 7
chicken(428974) PDZ domain containing 7
domestic cat(101094628) PDZ domain containing 7
dog(486847) PDZ domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024895 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024895 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243461 predicted 916
2 SASI_Hs02_00357491 predicted 462
3 SASI_Hs01_00243462 predicted 1084
4 SASI_Hs01_00243464 predicted 793
5 SASI_Hs01_00243465 predicted 995
6 SASI_Hs01_00243466 predicted 452
7 SASI_Hs01_00243467 predicted 444
8 SASI_Hs01_00243468 predicted 601
9 SASI_Hs01_00243469 predicted 1426
10 SASI_Hs01_00243470 predicted 1002
11 SASI_Hs01_00243463 predicted 447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024895
PDZD7 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1613s1c1
Sequence:CCGGGCTGATGAACCTCTTCTTCAACTCGAGTTGAAGAAGAGGTTCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1610s1c1
Sequence:CCGGGACGCTGATGAACCTCTTCTTCTCGAGAAGAAGAGGTTCATCAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1094s1c1
Sequence:CCGGGTATCCTGCCTACAAGGAGATCTCGAGATCTCCTTGTAGGCAGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024895.3-1807s1c1
Sequence:CCGGGTCTCCCAAAGTGCTAGGATTCTCGAGAATCCTAGCACTTTGGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1607s1c1
Sequence:CCGGCAAGACGCTGATGAACCTCTTCTCGAGAAGAGGTTCATCAGCGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-545s1c1
Sequence:CCGGCATCTTCGTCAGCAAAGTGGACTCGAGTCCACTTTGCTGACGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1101s1c1
Sequence:CCGGGCCTACAAGGAGATGGTTTCTCTCGAGAGAAACCATCTCCTTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-443s1c1
Sequence:CCGGCAACAGTGATGAAAGTGACATCTCGAGATGTCACTTTCATCACTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-915s1c1
Sequence:CCGGCTGGGCATCTATGTGTCCAAACTCGAGTTTGGACACATAGATGCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024895.3-1851s1c1
Sequence:CCGGCCAATCCCAACTACTCTGGAACTCGAGTTCCAGAGTAGTTGGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024895
PDZD7 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1613s1c1
Sequence:CCGGGCTGATGAACCTCTTCTTCAACTCGAGTTGAAGAAGAGGTTCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1610s1c1
Sequence:CCGGGACGCTGATGAACCTCTTCTTCTCGAGAAGAAGAGGTTCATCAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1094s1c1
Sequence:CCGGGTATCCTGCCTACAAGGAGATCTCGAGATCTCCTTGTAGGCAGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024895.3-1807s1c1
Sequence:CCGGGTCTCCCAAAGTGCTAGGATTCTCGAGAATCCTAGCACTTTGGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1607s1c1
Sequence:CCGGCAAGACGCTGATGAACCTCTTCTCGAGAAGAGGTTCATCAGCGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-545s1c1
Sequence:CCGGCATCTTCGTCAGCAAAGTGGACTCGAGTCCACTTTGCTGACGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1101s1c1
Sequence:CCGGGCCTACAAGGAGATGGTTTCTCTCGAGAGAAACCATCTCCTTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-443s1c1
Sequence:CCGGCAACAGTGATGAAAGTGACATCTCGAGATGTCACTTTCATCACTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-915s1c1
Sequence:CCGGCTGGGCATCTATGTGTCCAAACTCGAGTTTGGACACATAGATGCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024895.3-1851s1c1
Sequence:CCGGCCAATCCCAACTACTCTGGAACTCGAGTTCCAGAGTAGTTGGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024895
PDZD7 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1613s1c1
Sequence:CCGGGCTGATGAACCTCTTCTTCAACTCGAGTTGAAGAAGAGGTTCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1610s1c1
Sequence:CCGGGACGCTGATGAACCTCTTCTTCTCGAGAAGAAGAGGTTCATCAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1094s1c1
Sequence:CCGGGTATCCTGCCTACAAGGAGATCTCGAGATCTCCTTGTAGGCAGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024895.3-1807s1c1
Sequence:CCGGGTCTCCCAAAGTGCTAGGATTCTCGAGAATCCTAGCACTTTGGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1607s1c1
Sequence:CCGGCAAGACGCTGATGAACCTCTTCTCGAGAAGAGGTTCATCAGCGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-545s1c1
Sequence:CCGGCATCTTCGTCAGCAAAGTGGACTCGAGTCCACTTTGCTGACGAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-1101s1c1
Sequence:CCGGGCCTACAAGGAGATGGTTTCTCTCGAGAGAAACCATCTCCTTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-443s1c1
Sequence:CCGGCAACAGTGATGAAAGTGACATCTCGAGATGTCACTTTCATCACTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024895.3-915s1c1
Sequence:CCGGCTGGGCATCTATGTGTCCAAACTCGAGTTTGGACACATAGATGCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024895.3-1851s1c1
Sequence:CCGGCCAATCCCAACTACTCTGGAACTCGAGTTCCAGAGTAGTTGGGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)