EMAIL THIS PAGE TO A FRIEND

PDZD8

PDZ domain containing 8

54 Gene Product Result for
Synonyms: PDZK8 bA129M16.2
UniProtKB ID: Q8NEN9, Q86WE0, Q86WE5, Q9UFF1
Gene ID:
Mouse(107368) PDZ domain containing 8
Rat(308000) PDZ domain containing 8
Zebrafish(561279) PDZ domain containing 8
chicken(428984) PDZ domain containing 8
Horse(100067136) PDZ domain containing 8
domestic cat(101086755) PDZ domain containing 8
dog(486909) PDZ domain containing 8
domestic guinea pig(100718824) PDZ domain containing 8
naked mole-rat(101725211) PDZ domain containing 8
Domestic Rabbit(100355573) PDZ domain containing 8
cow(519573) PDZ domain containing 8
sheep(101121648) PDZ domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_140761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001033222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173791 Rosetta Predictions human pricing
NM_001107446 Rosetta Predictions rat pricing
NM_001033222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175890 predicted 1331
2 SASI_Hs01_00175891 predicted 2988
3 SASI_Hs01_00175892 predicted 2887
4 SASI_Hs02_00368645 predicted 2216
5 SASI_Hs02_00368646 predicted 1764
6 SASI_Hs01_00175893 predicted 3454
7 SASI_Hs01_00175894 predicted 3515
8 SASI_Hs01_00175895 predicted 2598
9 SASI_Hs01_00175896 predicted 2550
10 SASI_Hs01_00175897 predicted 3351
11 SASI_Hs01_00175898 predicted 2672
12 SASI_Hs01_00175899 predicted 3009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228905 predicted 1087
2 SASI_Rn02_00228906 predicted 3058
3 SASI_Rn02_00228907 predicted 2475
4 SASI_Rn02_00228908 predicted 3382
5 SASI_Rn02_00228909 predicted 2874
6 SASI_Rn02_00228910 predicted 3280
7 SASI_Rn02_00228911 predicted 1318
8 SASI_Rn02_00228912 predicted 1211
9 SASI_Rn02_00228913 predicted 3698
10 SASI_Rn02_00228914 predicted 1808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144766 predicted 1047
2 SASI_Mm01_00144767 predicted 1265
3 SASI_Mm01_00144768 predicted 3321
4 SASI_Mm01_00144771 predicted 2719
5 SASI_Mm02_00288345 predicted 3466
6 SASI_Mm01_00144773 predicted 1265
7 SASI_Mm01_00144774 predicted 1172
8 SASI_Mm01_00144775 predicted 1746
9 SASI_Mm02_00288346 predicted 3486
10 SASI_Mm02_00288347 predicted 2929
11 SASI_Mm01_00144769 predicted 2670
12 SASI_Mm01_00144770 predicted 2822
13 SASI_Mm01_00144772 predicted 3156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173791
VALIDATED
PDZD8 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 8
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2174s1c1
Sequence:CCGGGCCAAAGATGTCACTTCAGAACTCGAGTTCTGAAGTGACATCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3622s1c1
Sequence:CCGGCAGCAGCATATCAGATGACTTCTCGAGAAGTCATCTGATATGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-364s1c1
Sequence:CCGGGCTCCTAAGGGAGTACCTTTACTCGAGTAAAGGTACTCCCTTAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3489s1c1
Sequence:CCGGCAGGCATTGAAGATATAGAAACTCGAGTTTCTATATCTTCAATGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2749s1c1
Sequence:CCGGGAACCCAACATGGTGTGACTACTCGAGTAGTCACACCATGTTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2033s1c1
Sequence:CCGGGAACCAGATGTTCTCGTTGAACTCGAGTTCAACGAGAACATCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-2414s1c1
Sequence:CCGGGATGTGGCTTTAGGATGCCTACTCGAGTAGGCATCCTAAAGCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-1166s1c1
Sequence:CCGGCGTCTTAAAGTTACGTTGTTACTCGAGTAACAACGTAACTTTAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1165s1c1
Sequence:CCGGCCGTCTTAAAGTTACGTTGTTCTCGAGAACAACGTAACTTTAAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3698s1c1
Sequence:CCGGCAGGGTAAAGTTGCATCTAAACTCGAGTTTAGATGCAACTTTACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3344s1c1
Sequence:CCGGGATCAGGAGTTGGAACACAATCTCGAGATTGTGTTCCAACTCCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1730s1c1
Sequence:CCGGGAGTTCAAAGATGAGGCACAACTCGAGTTGTGCCTCATCTTTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1568s1c1
Sequence:CCGGGCAGTGCTGCAAGATAACTTTCTCGAGAAAGTTATCTTGCAGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3475s1c1
Sequence:CCGGGATTCACTACAGAGCAGGCATCTCGAGATGCCTGCTCTGTAGTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2891s1c1
Sequence:CCGGCGAATAGACAGGACACTGAAACTCGAGTTTCAGTGTCCTGTCTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173791
VALIDATED
PDZD8 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 8
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2174s1c1
Sequence:CCGGGCCAAAGATGTCACTTCAGAACTCGAGTTCTGAAGTGACATCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3622s1c1
Sequence:CCGGCAGCAGCATATCAGATGACTTCTCGAGAAGTCATCTGATATGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-364s1c1
Sequence:CCGGGCTCCTAAGGGAGTACCTTTACTCGAGTAAAGGTACTCCCTTAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3489s1c1
Sequence:CCGGCAGGCATTGAAGATATAGAAACTCGAGTTTCTATATCTTCAATGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2749s1c1
Sequence:CCGGGAACCCAACATGGTGTGACTACTCGAGTAGTCACACCATGTTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2033s1c1
Sequence:CCGGGAACCAGATGTTCTCGTTGAACTCGAGTTCAACGAGAACATCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-2414s1c1
Sequence:CCGGGATGTGGCTTTAGGATGCCTACTCGAGTAGGCATCCTAAAGCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-1166s1c1
Sequence:CCGGCGTCTTAAAGTTACGTTGTTACTCGAGTAACAACGTAACTTTAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1165s1c1
Sequence:CCGGCCGTCTTAAAGTTACGTTGTTCTCGAGAACAACGTAACTTTAAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3698s1c1
Sequence:CCGGCAGGGTAAAGTTGCATCTAAACTCGAGTTTAGATGCAACTTTACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3344s1c1
Sequence:CCGGGATCAGGAGTTGGAACACAATCTCGAGATTGTGTTCCAACTCCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1730s1c1
Sequence:CCGGGAGTTCAAAGATGAGGCACAACTCGAGTTGTGCCTCATCTTTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1568s1c1
Sequence:CCGGGCAGTGCTGCAAGATAACTTTCTCGAGAAAGTTATCTTGCAGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3475s1c1
Sequence:CCGGGATTCACTACAGAGCAGGCATCTCGAGATGCCTGCTCTGTAGTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2891s1c1
Sequence:CCGGCGAATAGACAGGACACTGAAACTCGAGTTTCAGTGTCCTGTCTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173791
VALIDATED
PDZD8 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 8
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2174s1c1
Sequence:CCGGGCCAAAGATGTCACTTCAGAACTCGAGTTCTGAAGTGACATCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3622s1c1
Sequence:CCGGCAGCAGCATATCAGATGACTTCTCGAGAAGTCATCTGATATGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-364s1c1
Sequence:CCGGGCTCCTAAGGGAGTACCTTTACTCGAGTAAAGGTACTCCCTTAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3489s1c1
Sequence:CCGGCAGGCATTGAAGATATAGAAACTCGAGTTTCTATATCTTCAATGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2749s1c1
Sequence:CCGGGAACCCAACATGGTGTGACTACTCGAGTAGTCACACCATGTTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2033s1c1
Sequence:CCGGGAACCAGATGTTCTCGTTGAACTCGAGTTCAACGAGAACATCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-2414s1c1
Sequence:CCGGGATGTGGCTTTAGGATGCCTACTCGAGTAGGCATCCTAAAGCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173791.2-1166s1c1
Sequence:CCGGCGTCTTAAAGTTACGTTGTTACTCGAGTAACAACGTAACTTTAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1165s1c1
Sequence:CCGGCCGTCTTAAAGTTACGTTGTTCTCGAGAACAACGTAACTTTAAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3698s1c1
Sequence:CCGGCAGGGTAAAGTTGCATCTAAACTCGAGTTTAGATGCAACTTTACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3344s1c1
Sequence:CCGGGATCAGGAGTTGGAACACAATCTCGAGATTGTGTTCCAACTCCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1730s1c1
Sequence:CCGGGAGTTCAAAGATGAGGCACAACTCGAGTTGTGCCTCATCTTTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-1568s1c1
Sequence:CCGGGCAGTGCTGCAAGATAACTTTCTCGAGAAAGTTATCTTGCAGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-3475s1c1
Sequence:CCGGGATTCACTACAGAGCAGGCATCTCGAGATGCCTGCTCTGTAGTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_173791.2-2891s1c1
Sequence:CCGGCGAATAGACAGGACACTGAAACTCGAGTTTCAGTGTCCTGTCTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140761
VALIDATED
PDZD8 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140761.4-961s1c1
Sequence:CCGGCGGCTTAAAGTTACATTGTTACTCGAGTAACAATGTAACTTTAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-853s1c1
Sequence:CCGGCCCAGTTACAAGATCAGGTTTCTCGAGAAACCTGATCTTGTAACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-1981s1c1
Sequence:CCGGCCTACTAAAGACTCTTCAGATCTCGAGATCTGAAGAGTCTTTAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-2809s1c1
Sequence:CCGGCGTTTACTAAATCTGCGTCAACTCGAGTTGACGCAGATTTAGTAAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-3266s1c1
Sequence:CCGGCGGGAATCGAAGATATTGAAACTCGAGTTTCAATATCTTCGATTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140761
VALIDATED
PDZD8 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140761.4-961s1c1
Sequence:CCGGCGGCTTAAAGTTACATTGTTACTCGAGTAACAATGTAACTTTAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-853s1c1
Sequence:CCGGCCCAGTTACAAGATCAGGTTTCTCGAGAAACCTGATCTTGTAACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-1981s1c1
Sequence:CCGGCCTACTAAAGACTCTTCAGATCTCGAGATCTGAAGAGTCTTTAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-2809s1c1
Sequence:CCGGCGTTTACTAAATCTGCGTCAACTCGAGTTGACGCAGATTTAGTAAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-3266s1c1
Sequence:CCGGCGGGAATCGAAGATATTGAAACTCGAGTTTCAATATCTTCGATTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140761
VALIDATED
PDZD8 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140761.4-961s1c1
Sequence:CCGGCGGCTTAAAGTTACATTGTTACTCGAGTAACAATGTAACTTTAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-853s1c1
Sequence:CCGGCCCAGTTACAAGATCAGGTTTCTCGAGAAACCTGATCTTGTAACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-1981s1c1
Sequence:CCGGCCTACTAAAGACTCTTCAGATCTCGAGATCTGAAGAGTCTTTAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-2809s1c1
Sequence:CCGGCGTTTACTAAATCTGCGTCAACTCGAGTTGACGCAGATTTAGTAAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_140761.4-3266s1c1
Sequence:CCGGCGGGAATCGAAGATATTGAAACTCGAGTTTCAATATCTTCGATTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033222
PDZD8 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 8
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000431056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-2847s21c1
Sequence:CCGGGAGCAACTGAGAGGCGAATAGCTCGAGCTATTCGCCTCTCAGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-1744s21c1
Sequence:CCGGACGTACTCCAACAACACTTTCCTCGAGGAAAGTGTTGTTGGAGTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-1278s21c1
Sequence:CCGGCTATTAAGACGGTTGAATTAACTCGAGTTAATTCAACCGTCTTAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033222
PDZD8 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 8
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000431056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-2847s21c1
Sequence:CCGGGAGCAACTGAGAGGCGAATAGCTCGAGCTATTCGCCTCTCAGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-1744s21c1
Sequence:CCGGACGTACTCCAACAACACTTTCCTCGAGGAAAGTGTTGTTGGAGTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-1278s21c1
Sequence:CCGGCTATTAAGACGGTTGAATTAACTCGAGTTAATTCAACCGTCTTAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033222
PDZD8 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 8
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000431056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-2847s21c1
Sequence:CCGGGAGCAACTGAGAGGCGAATAGCTCGAGCTATTCGCCTCTCAGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-1744s21c1
Sequence:CCGGACGTACTCCAACAACACTTTCCTCGAGGAAAGTGTTGTTGGAGTACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033222.3-1278s21c1
Sequence:CCGGCTATTAAGACGGTTGAATTAACTCGAGTTAATTCAACCGTCTTAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)