EMAIL THIS PAGE TO A FRIEND

PDZD9

PDZ domain containing 9

75 Gene Product Result for
Synonyms: C16orf65
UniProtKB ID: Q8IXQ8
Gene ID:
Mouse(67983) PDZ domain containing 9
Rat(308954) PDZ domain containing 9
cow(537386) PDZ domain containing 9
sheep(101102776) PDZ domain containing 9
naked mole-rat(101707878) PDZ domain containing 9
domestic guinea pig(100714066) PDZ domain containing 9
dog(489978) PDZ domain containing 9
domestic cat(101092225) PDZ domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173806 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173806 Rosetta Predictions human pricing
NM_001024777 Rosetta Predictions rat pricing
NM_001040136 Rosetta Predictions mouse pricing
NM_001040137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074573 predicted 723
2 SASI_Hs01_00074574 predicted 701
3 SASI_Hs02_00368662 predicted 727
4 SASI_Hs01_00074576 predicted 704
5 SASI_Hs01_00074578 predicted 569
6 SASI_Hs01_00074579 predicted 642
7 SASI_Hs01_00074580 predicted 664
8 SASI_Hs01_00074581 predicted 656
9 SASI_Hs01_00074582 predicted 789
10 SASI_Hs02_00368663 predicted 633
11 SASI_Hs01_00074575 predicted 797
12 SASI_Hs01_00074577 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103046 predicted 384
2 SASI_Rn02_00202666 predicted 484
3 SASI_Rn02_00202667 predicted 374
4 SASI_Rn01_00103047 predicted 491
5 SASI_Rn02_00202668 predicted 453
6 SASI_Rn01_00103051 predicted 519
7 SASI_Rn02_00202669 predicted 433
8 SASI_Rn01_00103053 predicted 499
9 SASI_Rn01_00103054 predicted 642
10 SASI_Rn02_00202670 predicted 664
11 SASI_Rn01_00103048 predicted 815
12 SASI_Rn01_00103049 predicted 838
13 SASI_Rn01_00103050 predicted 634
14 SASI_Rn01_00103052 predicted 355
15 SASI_Rn01_00103055 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290296 predicted 748
2 SASI_Mm02_00290297 predicted 720
3 SASI_Mm01_00130910 predicted 740
4 SASI_Mm01_00130911 predicted 731
5 SASI_Mm02_00290298 predicted 1332
6 SASI_Mm01_00130913 predicted 1243
7 SASI_Mm01_00130914 predicted 1278
8 SASI_Mm01_00130916 predicted 741
9 SASI_Mm01_00130918 predicted 711
10 SASI_Mm01_00130919 predicted 713
11 SASI_Mm01_00130912 predicted 1197
12 SASI_Mm01_00130915 predicted 1213
13 SASI_Mm01_00130917 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290299 predicted 777
2 SASI_Mm02_00290300 predicted 198
3 SASI_Mm02_00290301 predicted 722
4 SASI_Mm02_00290302 predicted 956
5 SASI_Mm02_00290303 predicted 694
6 SASI_Mm02_00290304 predicted 297
7 SASI_Mm02_00290305 predicted 204
8 SASI_Mm01_00081650 predicted 492
9 SASI_Mm02_00290306 predicted 455
10 SASI_Mm02_00290307 predicted 728
11 SASI_Mm01_00081641 predicted 513
12 SASI_Mm01_00081642 predicted 507
13 SASI_Mm01_00081643 predicted 974
14 SASI_Mm01_00081644 predicted 1019
15 SASI_Mm01_00081645 predicted 1056
16 SASI_Mm01_00081646 predicted 980
17 SASI_Mm01_00081647 predicted 518
18 SASI_Mm01_00081648 predicted 972
19 SASI_Mm01_00081649 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040136
PDZD9 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 9
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-441s21c1
Sequence:CCGGCATAGGGACAGTGCTACAAATCTCGAGATTTGTAGCACTGTCCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-881s21c1
Sequence:CCGGCCTTCTGGCTGGAGGATTATGCTCGAGCATAATCCTCCAGCCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040136.2-1008s21c1
Sequence:CCGGGCCTTACCATGGTGTTGATTTCTCGAGAAATCAACACCATGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-304s21c1
Sequence:CCGGATTAGCCACCTCATCAATAAACTCGAGTTTATTGATGAGGTGGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040136
PDZD9 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 9
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-441s21c1
Sequence:CCGGCATAGGGACAGTGCTACAAATCTCGAGATTTGTAGCACTGTCCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-881s21c1
Sequence:CCGGCCTTCTGGCTGGAGGATTATGCTCGAGCATAATCCTCCAGCCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040136.2-1008s21c1
Sequence:CCGGGCCTTACCATGGTGTTGATTTCTCGAGAAATCAACACCATGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-304s21c1
Sequence:CCGGATTAGCCACCTCATCAATAAACTCGAGTTTATTGATGAGGTGGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040136
PDZD9 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 9
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-441s21c1
Sequence:CCGGCATAGGGACAGTGCTACAAATCTCGAGATTTGTAGCACTGTCCCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-881s21c1
Sequence:CCGGCCTTCTGGCTGGAGGATTATGCTCGAGCATAATCCTCCAGCCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040136.2-1008s21c1
Sequence:CCGGGCCTTACCATGGTGTTGATTTCTCGAGAAATCAACACCATGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040136.2-304s21c1
Sequence:CCGGATTAGCCACCTCATCAATAAACTCGAGTTTATTGATGAGGTGGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173806
PDZD9 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-752s1c1
Sequence:CCGGGATTCACAGAGACGACAAGAACTCGAGTTCTTGTCGTCTCTGTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-568s1c1
Sequence:CCGGCTTTCACAAGCAGTGATGATACTCGAGTATCATCACTGCTTGTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-749s1c1
Sequence:CCGGGATGATTCACAGAGACGACAACTCGAGTTGTCGTCTCTGTGAATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-895s1c1
Sequence:CCGGGTAAAGCCCAACTGGTATCAACTCGAGTTGATACCAGTTGGGCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-433s1c1
Sequence:CCGGCAGTGCTACAAATCAAGGTTTCTCGAGAAACCTTGATTTGTAGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-424s1c1
Sequence:CCGGCTATTGGAACAGTGCTACAAACTCGAGTTTGTAGCACTGTTCCAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-564s1c1
Sequence:CCGGGAATCTTTCACAAGCAGTGATCTCGAGATCACTGCTTGTGAAAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-879s1c1
Sequence:CCGGGCCCAAGTTGAAGAGGGTAAACTCGAGTTTACCCTCTTCAACTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-867s1c1
Sequence:CCGGCTGGAAGATTGTGCCCAAGTTCTCGAGAACTTGGGCACAATCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-441s1c1
Sequence:CCGGCAAATCAAGGTTTACCGAGATCTCGAGATCTCGGTAAACCTTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173806
PDZD9 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-752s1c1
Sequence:CCGGGATTCACAGAGACGACAAGAACTCGAGTTCTTGTCGTCTCTGTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-568s1c1
Sequence:CCGGCTTTCACAAGCAGTGATGATACTCGAGTATCATCACTGCTTGTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-749s1c1
Sequence:CCGGGATGATTCACAGAGACGACAACTCGAGTTGTCGTCTCTGTGAATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-895s1c1
Sequence:CCGGGTAAAGCCCAACTGGTATCAACTCGAGTTGATACCAGTTGGGCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-433s1c1
Sequence:CCGGCAGTGCTACAAATCAAGGTTTCTCGAGAAACCTTGATTTGTAGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-424s1c1
Sequence:CCGGCTATTGGAACAGTGCTACAAACTCGAGTTTGTAGCACTGTTCCAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-564s1c1
Sequence:CCGGGAATCTTTCACAAGCAGTGATCTCGAGATCACTGCTTGTGAAAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-879s1c1
Sequence:CCGGGCCCAAGTTGAAGAGGGTAAACTCGAGTTTACCCTCTTCAACTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-867s1c1
Sequence:CCGGCTGGAAGATTGTGCCCAAGTTCTCGAGAACTTGGGCACAATCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-441s1c1
Sequence:CCGGCAAATCAAGGTTTACCGAGATCTCGAGATCTCGGTAAACCTTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173806
PDZD9 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-752s1c1
Sequence:CCGGGATTCACAGAGACGACAAGAACTCGAGTTCTTGTCGTCTCTGTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-568s1c1
Sequence:CCGGCTTTCACAAGCAGTGATGATACTCGAGTATCATCACTGCTTGTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-749s1c1
Sequence:CCGGGATGATTCACAGAGACGACAACTCGAGTTGTCGTCTCTGTGAATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-895s1c1
Sequence:CCGGGTAAAGCCCAACTGGTATCAACTCGAGTTGATACCAGTTGGGCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-433s1c1
Sequence:CCGGCAGTGCTACAAATCAAGGTTTCTCGAGAAACCTTGATTTGTAGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-424s1c1
Sequence:CCGGCTATTGGAACAGTGCTACAAACTCGAGTTTGTAGCACTGTTCCAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-564s1c1
Sequence:CCGGGAATCTTTCACAAGCAGTGATCTCGAGATCACTGCTTGTGAAAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-879s1c1
Sequence:CCGGGCCCAAGTTGAAGAGGGTAAACTCGAGTTTACCCTCTTCAACTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-867s1c1
Sequence:CCGGCTGGAAGATTGTGCCCAAGTTCTCGAGAACTTGGGCACAATCTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173806.2-441s1c1
Sequence:CCGGCAAATCAAGGTTTACCGAGATCTCGAGATCTCGGTAAACCTTGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)