EMAIL THIS PAGE TO A FRIEND

PDZK1

PDZ domain containing 1

54 Gene Product Result for
Synonyms: CAP70 CLAMP NHERF-3 NHERF3 PDZD1
UniProtKB ID: Q5T2W1, B4DPB9, E7EU02, O60450, Q5T5P6, Q9BQ41
Gene ID:
Human(5174) Summary: This gene encodes a PDZ domain-containing scaffolding protein. PDZ domain-containing molecules bind to and mediate the subcellular localization of target proteins. The encoded protein mediates the localization of cell surface proteins and plays a critical role in cholesterol metabolism by regulating the HDL receptor, scavenger receptor class B type 1. Single nucleotide polymorphisms in this gene may be associated with metabolic syndrome, and overexpression of this gene may play a role in drug resistance of multiple myeloma. Pseudogenes of this gene are located on the long arm of chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(59020) PDZ domain containing 1
Rat(65144) PDZ domain containing 1
Zebrafish(337325) PDZ domain containing 1
dog(475823) PDZ domain containing 1
Horse(100065636) PDZ domain containing 1
domestic cat(101096825) PDZ domain containing 1
chicken(418460) PDZ domain containing 1
domestic guinea pig(100729774) PDZ domain containing 1
naked mole-rat(101696284) PDZ domain containing 1
Domestic Rabbit(100008900) PDZ domain containing 1
cow(534439) PDZ domain containing 1
sheep(101116106) PDZ domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002614 Rosetta Predictions human pricing
NM_031712 Rosetta Predictions rat pricing
NM_021517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334127 predicted 818
2 SASI_Hs01_00210450 predicted 727
3 SASI_Hs01_00210451 predicted 881
4 SASI_Hs01_00210452 predicted 1035
5 SASI_Hs02_00334128 predicted 1031
6 SASI_Hs01_00210454 predicted 341
7 SASI_Hs01_00210455 predicted 1728
8 SASI_Hs01_00210456 predicted 569
9 SASI_Hs01_00210457 predicted 431
10 SASI_Hs01_00210458 predicted 897
11 SASI_Hs01_00210449 predicted 1452
12 SASI_Hs01_00210453 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099933 predicted 1097
2 SASI_Rn01_00099935 predicted 332
3 SASI_Rn01_00099936 predicted 1235
4 SASI_Rn01_00099937 predicted 286
5 SASI_Rn01_00099938 predicted 926
6 SASI_Rn01_00099939 predicted 641
7 SASI_Rn01_00099940 predicted 877
8 SASI_Rn02_00265075 predicted 1012
9 SASI_Rn01_00099941 predicted 711
10 SASI_Rn01_00099942 predicted 307
11 SASI_Rn01_00099934 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200990 predicted 1059
2 SASI_Mm01_00200991 predicted 495
3 SASI_Mm01_00200992 predicted 1191
4 SASI_Mm01_00200993 predicted 551
5 SASI_Mm02_00326243 predicted 825
6 SASI_Mm01_00200994 predicted 881
7 SASI_Mm01_00200995 predicted 250
8 SASI_Mm01_00200996 predicted 675
9 SASI_Mm01_00200998 predicted 1414
10 SASI_Mm01_00200999 predicted 641
11 SASI_Mm01_00200997 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002614
PDZK1 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-430s1c1
Sequence:CCGGGCAAGGTTTGAGTGATAATATCTCGAGATATTATCACTCAAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-263s1c1
Sequence:CCGGCTTAGGATCAATGGTGTCTTTCTCGAGAAAGACACCATTGATCCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-672s1c1
Sequence:CCGGGCCATGAGGAAGTGGTTGAAACTCGAGTTTCAACCACTTCCTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-876s1c1
Sequence:CCGGGCTCAGAACAGAAAGGTCAAACTCGAGTTTGACCTTTCTGTTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-1473s1c1
Sequence:CCGGCCTATGATTATTTCCAAGCTACTCGAGTAGCTTGGAAATAATCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002614.3-1914s21c1
Sequence:CCGGCTTCAACTTAACTTAACTACACTCGAGTGTAGTTAAGTTAAGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002614.3-568s21c1
Sequence:CCGGGGTGTACATGACTGATATTACCTCGAGGTAATATCAGTCATGTACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002614.3-125s21c1
Sequence:CCGGTGTAAACTGTCCAAGCAAGAACTCGAGTTCTTGCTTGGACAGTTTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002614
PDZK1 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-430s1c1
Sequence:CCGGGCAAGGTTTGAGTGATAATATCTCGAGATATTATCACTCAAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-263s1c1
Sequence:CCGGCTTAGGATCAATGGTGTCTTTCTCGAGAAAGACACCATTGATCCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-672s1c1
Sequence:CCGGGCCATGAGGAAGTGGTTGAAACTCGAGTTTCAACCACTTCCTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-876s1c1
Sequence:CCGGGCTCAGAACAGAAAGGTCAAACTCGAGTTTGACCTTTCTGTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-1473s1c1
Sequence:CCGGCCTATGATTATTTCCAAGCTACTCGAGTAGCTTGGAAATAATCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002614.3-1914s21c1
Sequence:CCGGCTTCAACTTAACTTAACTACACTCGAGTGTAGTTAAGTTAAGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002614.3-568s21c1
Sequence:CCGGGGTGTACATGACTGATATTACCTCGAGGTAATATCAGTCATGTACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002614.3-125s21c1
Sequence:CCGGTGTAAACTGTCCAAGCAAGAACTCGAGTTCTTGCTTGGACAGTTTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002614
PDZK1 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-430s1c1
Sequence:CCGGGCAAGGTTTGAGTGATAATATCTCGAGATATTATCACTCAAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-263s1c1
Sequence:CCGGCTTAGGATCAATGGTGTCTTTCTCGAGAAAGACACCATTGATCCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-672s1c1
Sequence:CCGGGCCATGAGGAAGTGGTTGAAACTCGAGTTTCAACCACTTCCTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-876s1c1
Sequence:CCGGGCTCAGAACAGAAAGGTCAAACTCGAGTTTGACCTTTCTGTTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002614.3-1473s1c1
Sequence:CCGGCCTATGATTATTTCCAAGCTACTCGAGTAGCTTGGAAATAATCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002614.3-1914s21c1
Sequence:CCGGCTTCAACTTAACTTAACTACACTCGAGTGTAGTTAAGTTAAGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002614.3-568s21c1
Sequence:CCGGGGTGTACATGACTGATATTACCTCGAGGTAATATCAGTCATGTACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002614.3-125s21c1
Sequence:CCGGTGTAAACTGTCCAAGCAAGAACTCGAGTTCTTGCTTGGACAGTTTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021517
PDZK1 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021517.1-1907s1c1
Sequence:CCGGCCTGTTATAGAAGTGTGCTTTCTCGAGAAAGCACACTTCTATAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-942s1c1
Sequence:CCGGTGTGGTGGAAATGATTAGAAACTCGAGTTTCTAATCATTTCCACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-559s1c1
Sequence:CCGGGCTGATGATCACTTGATTGAACTCGAGTTCAATCAAGTGATCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-1049s1c1
Sequence:CCGGGCCAAAGTCAAGAACTGCCTACTCGAGTAGGCAGTTCTTGACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-367s1c1
Sequence:CCGGGCCGCTCTGAATGATAAGAAACTCGAGTTTCTTATCATTCAGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021517
PDZK1 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021517.1-1907s1c1
Sequence:CCGGCCTGTTATAGAAGTGTGCTTTCTCGAGAAAGCACACTTCTATAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-942s1c1
Sequence:CCGGTGTGGTGGAAATGATTAGAAACTCGAGTTTCTAATCATTTCCACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-559s1c1
Sequence:CCGGGCTGATGATCACTTGATTGAACTCGAGTTCAATCAAGTGATCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-1049s1c1
Sequence:CCGGGCCAAAGTCAAGAACTGCCTACTCGAGTAGGCAGTTCTTGACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-367s1c1
Sequence:CCGGGCCGCTCTGAATGATAAGAAACTCGAGTTTCTTATCATTCAGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021517
PDZK1 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021517.1-1907s1c1
Sequence:CCGGCCTGTTATAGAAGTGTGCTTTCTCGAGAAAGCACACTTCTATAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-942s1c1
Sequence:CCGGTGTGGTGGAAATGATTAGAAACTCGAGTTTCTAATCATTTCCACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-559s1c1
Sequence:CCGGGCTGATGATCACTTGATTGAACTCGAGTTCAATCAAGTGATCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-1049s1c1
Sequence:CCGGGCCAAAGTCAAGAACTGCCTACTCGAGTAGGCAGTTCTTGACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021517.1-367s1c1
Sequence:CCGGGCCGCTCTGAATGATAAGAAACTCGAGTTTCTTATCATTCAGAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)