EMAIL THIS PAGE TO A FRIEND

PDZK1IP1

PDZK1 interacting protein 1

49 Gene Product Result for
Synonyms: DD96 MAP17 RP1-18D14.5 SPAP
UniProtKB ID: Q13113, Q6ICT9, Q96EI1
Gene ID:
Mouse(67182) PDZK1 interacting protein 1
Rat(81916) PDZK1 interacting protein 1
cow(613915) PDZK1 interacting protein 1
sheep(101106377) PDZK1 interacting protein 1
naked mole-rat(101706483) PDZK1 interacting protein 1
domestic guinea pig(100714891) PDZK1 interacting protein 1
chicken(424619) PDZK1 interacting protein 1
domestic cat(101097162) PDZK1 interacting protein 1
dog(475365) PDZK1 interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014907 Anti-PDZK1IP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005764 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005764 Rosetta Predictions human pricing
NM_130401 Rosetta Predictions rat pricing
NM_026018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170343 predicted 437
2 SASI_Hs01_00170345 predicted 410
3 SASI_Hs01_00170346 predicted 260
4 SASI_Hs01_00170347 predicted 543
5 SASI_Hs01_00170348 predicted 537
6 SASI_Hs01_00170349 predicted 440
7 SASI_Hs01_00170350 predicted 270
8 SASI_Hs01_00170351 predicted 425
9 SASI_Hs01_00170352 predicted 396
10 SASI_Hs02_00340241 predicted 501
11 SASI_Hs01_00170344 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040855 predicted 518
2 SASI_Rn01_00040856 predicted 200
3 SASI_Rn01_00040857 predicted 385
4 SASI_Rn01_00040858 predicted 339
5 SASI_Rn01_00040859 predicted 480
6 SASI_Rn01_00040862 predicted 519
7 SASI_Rn01_00040863 predicted 545
8 SASI_Rn01_00040864 predicted 242
9 SASI_Rn02_00267380 predicted 541
10 SASI_Rn02_00267381 predicted 210
11 SASI_Rn01_00040860 predicted 494
12 SASI_Rn01_00040861 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033357 predicted 862
2 SASI_Mm01_00033358 predicted 475
3 SASI_Mm01_00033359 predicted 704
4 SASI_Mm01_00033360 predicted 837
5 SASI_Mm01_00033361 predicted 707
6 SASI_Mm01_00033362 predicted 424
7 SASI_Mm01_00033363 predicted 706
8 SASI_Mm02_00329485 predicted 533
9 SASI_Mm01_00033364 predicted 479
10 SASI_Mm01_00033365 predicted 528
11 SASI_Mm01_00033366 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005764
PDZK1IP1 MISSION shRNA Bacterial Glycerol Stock
PDZK1 interacting protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005764.3-591s21c1
Sequence:CCGGCTTTGTGTGGAATCTGCAATACTCGAGTATTGCAGATTCCACACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-438s1c1
Sequence:CCGGAGGTCCAGTGAGCATGAGAATCTCGAGATTCTCATGCTCACTGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-400s1c1
Sequence:CCGGGAACAGATGGAAGGTACTCTTCTCGAGAAGAGTACCTTCCATCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-307s1c1
Sequence:CCGGCCTTTGCAGTCAACCACTTCTCTCGAGAGAAGTGGTTGACTGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-366s1c1
Sequence:CCGGACCGTCGGAAACAAGGCAGATCTCGAGATCTGCCTTGTTTCCGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-449s1c1
Sequence:CCGGGCATGAGAATGCCTATGAGAACTCGAGTTCTCATAGGCATTCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005764.3-675s21c1
Sequence:CCGGTTGGAGCTCAGACCGTGTCTACTCGAGTAGACACGGTCTGAGCTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005764.3-285s21c1
Sequence:CCGGTTCCTGGTCCTCGTTGCAATCCTCGAGGATTGCAACGAGGACCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005764
PDZK1IP1 MISSION shRNA shRNA Plasmid DNA
PDZK1 interacting protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005764.3-591s21c1
Sequence:CCGGCTTTGTGTGGAATCTGCAATACTCGAGTATTGCAGATTCCACACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-438s1c1
Sequence:CCGGAGGTCCAGTGAGCATGAGAATCTCGAGATTCTCATGCTCACTGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-400s1c1
Sequence:CCGGGAACAGATGGAAGGTACTCTTCTCGAGAAGAGTACCTTCCATCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-307s1c1
Sequence:CCGGCCTTTGCAGTCAACCACTTCTCTCGAGAGAAGTGGTTGACTGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-366s1c1
Sequence:CCGGACCGTCGGAAACAAGGCAGATCTCGAGATCTGCCTTGTTTCCGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-449s1c1
Sequence:CCGGGCATGAGAATGCCTATGAGAACTCGAGTTCTCATAGGCATTCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005764.3-675s21c1
Sequence:CCGGTTGGAGCTCAGACCGTGTCTACTCGAGTAGACACGGTCTGAGCTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005764.3-285s21c1
Sequence:CCGGTTCCTGGTCCTCGTTGCAATCCTCGAGGATTGCAACGAGGACCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005764
PDZK1IP1 MISSION shRNA Lentiviral Transduction Particles
PDZK1 interacting protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005764.3-591s21c1
Sequence:CCGGCTTTGTGTGGAATCTGCAATACTCGAGTATTGCAGATTCCACACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-438s1c1
Sequence:CCGGAGGTCCAGTGAGCATGAGAATCTCGAGATTCTCATGCTCACTGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-400s1c1
Sequence:CCGGGAACAGATGGAAGGTACTCTTCTCGAGAAGAGTACCTTCCATCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-307s1c1
Sequence:CCGGCCTTTGCAGTCAACCACTTCTCTCGAGAGAAGTGGTTGACTGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-366s1c1
Sequence:CCGGACCGTCGGAAACAAGGCAGATCTCGAGATCTGCCTTGTTTCCGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005764.3-449s1c1
Sequence:CCGGGCATGAGAATGCCTATGAGAACTCGAGTTCTCATAGGCATTCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005764.3-675s21c1
Sequence:CCGGTTGGAGCTCAGACCGTGTCTACTCGAGTAGACACGGTCTGAGCTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005764.3-285s21c1
Sequence:CCGGTTCCTGGTCCTCGTTGCAATCCTCGAGGATTGCAACGAGGACCAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026018
PDZK1IP1 MISSION shRNA Bacterial Glycerol Stock
PDZK1 interacting protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-522s21c1
Sequence:CCGGCCTCATTGCTGTCGCTGTGTTCTCGAGAACACAGCGACAGCAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-608s21c1
Sequence:CCGGGGAGCACAGTGATGATCATTGCTCGAGCAATGATCATCACTGTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026018.1-613s1c1
Sequence:CCGGCACAGTGATGATCATTGGAAACTCGAGTTTCCAATGATCATCACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026018.1-666s1c1
Sequence:CCGGGCAGATACTCCTCAATGGCATCTCGAGATGCCATTGAGGAGTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026018.1-844s1c1
Sequence:CCGGGCTCTACAGGAATCTACTGAACTCGAGTTCAGTAGATTCCTGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-661s21c1
Sequence:CCGGGATGGCAGATACTCCTCAATGCTCGAGCATTGAGGAGTATCTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-707s21c1
Sequence:CCGGACAAGAATGCCTACGAGAATGCTCGAGCATTCTCGTAGGCATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026018.2-845s21c1
Sequence:CCGGTCTACAGGAATCTACTGAAACCTCGAGGTTTCAGTAGATTCCTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026018
PDZK1IP1 MISSION shRNA shRNA Plasmid DNA
PDZK1 interacting protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-522s21c1
Sequence:CCGGCCTCATTGCTGTCGCTGTGTTCTCGAGAACACAGCGACAGCAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-608s21c1
Sequence:CCGGGGAGCACAGTGATGATCATTGCTCGAGCAATGATCATCACTGTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026018.1-613s1c1
Sequence:CCGGCACAGTGATGATCATTGGAAACTCGAGTTTCCAATGATCATCACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026018.1-666s1c1
Sequence:CCGGGCAGATACTCCTCAATGGCATCTCGAGATGCCATTGAGGAGTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026018.1-844s1c1
Sequence:CCGGGCTCTACAGGAATCTACTGAACTCGAGTTCAGTAGATTCCTGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-661s21c1
Sequence:CCGGGATGGCAGATACTCCTCAATGCTCGAGCATTGAGGAGTATCTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-707s21c1
Sequence:CCGGACAAGAATGCCTACGAGAATGCTCGAGCATTCTCGTAGGCATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026018.2-845s21c1
Sequence:CCGGTCTACAGGAATCTACTGAAACCTCGAGGTTTCAGTAGATTCCTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026018
PDZK1IP1 MISSION shRNA Lentiviral Transduction Particles
PDZK1 interacting protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-522s21c1
Sequence:CCGGCCTCATTGCTGTCGCTGTGTTCTCGAGAACACAGCGACAGCAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-608s21c1
Sequence:CCGGGGAGCACAGTGATGATCATTGCTCGAGCAATGATCATCACTGTGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026018.1-613s1c1
Sequence:CCGGCACAGTGATGATCATTGGAAACTCGAGTTTCCAATGATCATCACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026018.1-666s1c1
Sequence:CCGGGCAGATACTCCTCAATGGCATCTCGAGATGCCATTGAGGAGTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026018.1-844s1c1
Sequence:CCGGGCTCTACAGGAATCTACTGAACTCGAGTTCAGTAGATTCCTGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-661s21c1
Sequence:CCGGGATGGCAGATACTCCTCAATGCTCGAGCATTGAGGAGTATCTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026018.2-707s21c1
Sequence:CCGGACAAGAATGCCTACGAGAATGCTCGAGCATTCTCGTAGGCATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026018.2-845s21c1
Sequence:CCGGTCTACAGGAATCTACTGAAACCTCGAGGTTTCAGTAGATTCCTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)