EMAIL THIS PAGE TO A FRIEND

PDZRN3

PDZ domain containing ring finger 3

106 Gene Product Result for
Synonyms: LNX3 SEMACAP3
UniProtKB ID: Q9UPQ7, A7MCZ6, Q8N2N7, Q96CC2, Q9NSQ2
Gene ID:
Mouse(55983) PDZ domain containing RING finger 3
Rat(312607) PDZ domain containing RING finger 3
Zebrafish(100149029) PDZ domain containing ring finger 3
dog(100687532) PDZ domain containing ring finger 3
Horse(100061813) PDZ domain containing ring finger 3
domestic cat(101094578) PDZ domain containing ring finger 3
chicken(416099) PDZ domain containing RING finger 3
domestic guinea pig(100733896) PDZ domain containing ring finger 3
naked mole-rat(101696410) PDZ domain containing ring finger 3
cow(509083) PDZ domain containing ring finger 3
sheep(101104097) PDZ domain containing ring finger 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015009 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015009 Rosetta Predictions human pricing
XM_001075473 Rosetta Predictions rat pricing
XM_232226 Rosetta Predictions rat pricing
NM_018884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111248 predicted 1446
2 SASI_Hs01_00111249 predicted 985
3 SASI_Hs01_00111250 predicted 836
4 SASI_Hs02_00346779 predicted 3351
5 SASI_Hs01_00111251 predicted 1425
6 SASI_Hs01_00111252 predicted 1441
7 SASI_Hs01_00111253 predicted 926
8 SASI_Hs01_00111254 predicted 989
9 SASI_Hs01_00111255 predicted 3307
10 SASI_Hs01_00111256 predicted 1755
11 SASI_Hs01_00111257 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349864 predicted 3192
2 SASI_Rn02_00349865 predicted 2449
3 SASI_Rn02_00349866 predicted 1559
4 SASI_Rn02_00349867 predicted 1410
5 SASI_Rn02_00349868 predicted 1417
6 SASI_Rn02_00349869 predicted 1346
7 SASI_Rn02_00349870 predicted 831
8 SASI_Rn02_00349871 predicted 3109
9 SASI_Rn02_00349872 predicted 3184
10 SASI_Rn02_00349873 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387021 predicted 3198
2 SASI_Rn02_00387022 predicted 2453
3 SASI_Rn02_00387023 predicted 1558
4 SASI_Rn02_00387024 predicted 1411
5 SASI_Rn02_00387025 predicted 1429
6 SASI_Rn02_00387026 predicted 1352
7 SASI_Rn02_00387027 predicted 833
8 SASI_Rn02_00387028 predicted 3116
9 SASI_Rn02_00387029 predicted 3190
10 SASI_Rn02_00387030 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079284 predicted 3197
2 SASI_Mm01_00079285 predicted 1414
3 SASI_Mm02_00324297 predicted 222
4 SASI_Mm01_00079288 predicted 1095
5 SASI_Mm01_00079289 predicted 1357
6 SASI_Mm02_00324298 predicted 3092
7 SASI_Mm02_00324299 predicted 1359
8 SASI_Mm01_00079291 predicted 3125
9 SASI_Mm01_00079292 predicted 2347
10 SASI_Mm01_00079293 predicted 3183
11 SASI_Mm01_00079286 predicted 753
12 SASI_Mm01_00079287 predicted 902
13 SASI_Mm01_00079290 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015009
VALIDATED
PDZRN3 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing ring finger 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1634s21c1
Sequence:CCGGATGATGACAGGAACGACTTTCCTCGAGGAAAGTCGTTCCTGTCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1844s21c1
Sequence:CCGGGCTCGGAGCAAGAGAACAATGCTCGAGCATTGTTCTCTTGCTCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-923s21c1
Sequence:CCGGCATCCAGTGAAGGAATCTTTGCTCGAGCAAAGATTCCTTCACTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-1420s1c1
Sequence:CCGGGAAGACGACATTGGGATTTATCTCGAGATAAATCCCAATGTCGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015009.1-986s1c1
Sequence:CCGGGCCTGCAAATTCATGACAGGACTCGAGTCCTGTCATGAATTTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1276s21c1
Sequence:CCGGCATGAATACTACGATCCAAATCTCGAGATTTGGATCGTAGTATTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-745s21c1
Sequence:CCGGCAGAAGAAATTCACCGAATACCTCGAGGTATTCGGTGAATTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015009.1-3260s1c1
Sequence:CCGGGAGTATACAATTCCTTCCTATCTCGAGATAGGAAGGAATTGTATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-3730s1c1
Sequence:CCGGCGTTACTGAATGTGTTTCATACTCGAGTATGAAACACATTCAGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1955s21c1
Sequence:CCGGTCAGCAACGAGTCTTTCATTTCTCGAGAAATGAAAGACTCGTTGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-3978s1c1
Sequence:CCGGGCCCATTGAAAGAATTTGCATCTCGAGATGCAAATTCTTTCAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015009
VALIDATED
PDZRN3 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing ring finger 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1634s21c1
Sequence:CCGGATGATGACAGGAACGACTTTCCTCGAGGAAAGTCGTTCCTGTCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1844s21c1
Sequence:CCGGGCTCGGAGCAAGAGAACAATGCTCGAGCATTGTTCTCTTGCTCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-923s21c1
Sequence:CCGGCATCCAGTGAAGGAATCTTTGCTCGAGCAAAGATTCCTTCACTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-1420s1c1
Sequence:CCGGGAAGACGACATTGGGATTTATCTCGAGATAAATCCCAATGTCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015009.1-986s1c1
Sequence:CCGGGCCTGCAAATTCATGACAGGACTCGAGTCCTGTCATGAATTTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1276s21c1
Sequence:CCGGCATGAATACTACGATCCAAATCTCGAGATTTGGATCGTAGTATTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-745s21c1
Sequence:CCGGCAGAAGAAATTCACCGAATACCTCGAGGTATTCGGTGAATTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015009.1-3260s1c1
Sequence:CCGGGAGTATACAATTCCTTCCTATCTCGAGATAGGAAGGAATTGTATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-3730s1c1
Sequence:CCGGCGTTACTGAATGTGTTTCATACTCGAGTATGAAACACATTCAGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1955s21c1
Sequence:CCGGTCAGCAACGAGTCTTTCATTTCTCGAGAAATGAAAGACTCGTTGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-3978s1c1
Sequence:CCGGGCCCATTGAAAGAATTTGCATCTCGAGATGCAAATTCTTTCAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015009
VALIDATED
PDZRN3 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing ring finger 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1634s21c1
Sequence:CCGGATGATGACAGGAACGACTTTCCTCGAGGAAAGTCGTTCCTGTCATCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1844s21c1
Sequence:CCGGGCTCGGAGCAAGAGAACAATGCTCGAGCATTGTTCTCTTGCTCCGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-923s21c1
Sequence:CCGGCATCCAGTGAAGGAATCTTTGCTCGAGCAAAGATTCCTTCACTGGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-1420s1c1
Sequence:CCGGGAAGACGACATTGGGATTTATCTCGAGATAAATCCCAATGTCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015009.1-986s1c1
Sequence:CCGGGCCTGCAAATTCATGACAGGACTCGAGTCCTGTCATGAATTTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1276s21c1
Sequence:CCGGCATGAATACTACGATCCAAATCTCGAGATTTGGATCGTAGTATTCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-745s21c1
Sequence:CCGGCAGAAGAAATTCACCGAATACCTCGAGGTATTCGGTGAATTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015009.1-3260s1c1
Sequence:CCGGGAGTATACAATTCCTTCCTATCTCGAGATAGGAAGGAATTGTATACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-3730s1c1
Sequence:CCGGCGTTACTGAATGTGTTTCATACTCGAGTATGAAACACATTCAGTAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015009.1-1955s21c1
Sequence:CCGGTCAGCAACGAGTCTTTCATTTCTCGAGAAATGAAAGACTCGTTGCTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015009.1-3978s1c1
Sequence:CCGGGCCCATTGAAAGAATTTGCATCTCGAGATGCAAATTCTTTCAATGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018884
VALIDATED
PDZRN3 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing ring finger 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-1465s21c1
Sequence:CCGGGCGCTTCTAACCAGTGAAGAACTCGAGTTCTTCACTGGTTAGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-1333s21c1
Sequence:CCGGGAAGATGACATTGGGATATATCTCGAGATATATCCCAATGTCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-904s21c1
Sequence:CCGGCAAATTCATGACAGGATTATTCTCGAGAATAATCCTGTCATGAATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018884.1-3654s21c1
Sequence:CCGGTTCATTCATACAGCTTATATCCTCGAGGATATAAGCTGTATGAATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018884.1-935s1c1
Sequence:CCGGGCAAAGACTTATCCCGAGCAACTCGAGTTGCTCGGGATAAGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-935s21c1
Sequence:CCGGGCAAAGACTTATCCCGAGCAACTCGAGTTGCTCGGGATAAGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-3293s1c1
Sequence:CCGGGCCATCATGTTGATAGTCTAACTCGAGTTAGACTATCAACATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-3180s1c1
Sequence:CCGGCCTGTCGGTGACTACTGTATACTCGAGTATACAGTAGTCACCGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-1465s1c1
Sequence:CCGGGCGCTTCTAACCAGTGAAGAACTCGAGTTCTTCACTGGTTAGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-1183s1c1
Sequence:CCGGGCATCCCATGACTACTATGATCTCGAGATCATAGTAGTCATGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018884
VALIDATED
PDZRN3 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing ring finger 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-1465s21c1
Sequence:CCGGGCGCTTCTAACCAGTGAAGAACTCGAGTTCTTCACTGGTTAGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-1333s21c1
Sequence:CCGGGAAGATGACATTGGGATATATCTCGAGATATATCCCAATGTCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-904s21c1
Sequence:CCGGCAAATTCATGACAGGATTATTCTCGAGAATAATCCTGTCATGAATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018884.1-3654s21c1
Sequence:CCGGTTCATTCATACAGCTTATATCCTCGAGGATATAAGCTGTATGAATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018884.1-935s1c1
Sequence:CCGGGCAAAGACTTATCCCGAGCAACTCGAGTTGCTCGGGATAAGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-935s21c1
Sequence:CCGGGCAAAGACTTATCCCGAGCAACTCGAGTTGCTCGGGATAAGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-3293s1c1
Sequence:CCGGGCCATCATGTTGATAGTCTAACTCGAGTTAGACTATCAACATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-3180s1c1
Sequence:CCGGCCTGTCGGTGACTACTGTATACTCGAGTATACAGTAGTCACCGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-1465s1c1
Sequence:CCGGGCGCTTCTAACCAGTGAAGAACTCGAGTTCTTCACTGGTTAGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-1183s1c1
Sequence:CCGGGCATCCCATGACTACTATGATCTCGAGATCATAGTAGTCATGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018884
VALIDATED
PDZRN3 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing ring finger 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-1465s21c1
Sequence:CCGGGCGCTTCTAACCAGTGAAGAACTCGAGTTCTTCACTGGTTAGAAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-1333s21c1
Sequence:CCGGGAAGATGACATTGGGATATATCTCGAGATATATCCCAATGTCATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-904s21c1
Sequence:CCGGCAAATTCATGACAGGATTATTCTCGAGAATAATCCTGTCATGAATTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018884.1-3654s21c1
Sequence:CCGGTTCATTCATACAGCTTATATCCTCGAGGATATAAGCTGTATGAATGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018884.1-935s1c1
Sequence:CCGGGCAAAGACTTATCCCGAGCAACTCGAGTTGCTCGGGATAAGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018884.1-935s21c1
Sequence:CCGGGCAAAGACTTATCCCGAGCAACTCGAGTTGCTCGGGATAAGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-3293s1c1
Sequence:CCGGGCCATCATGTTGATAGTCTAACTCGAGTTAGACTATCAACATGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-3180s1c1
Sequence:CCGGCCTGTCGGTGACTACTGTATACTCGAGTATACAGTAGTCACCGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-1465s1c1
Sequence:CCGGGCGCTTCTAACCAGTGAAGAACTCGAGTTCTTCACTGGTTAGAAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018884.1-1183s1c1
Sequence:CCGGGCATCCCATGACTACTATGATCTCGAGATCATAGTAGTCATGGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)