EMAIL THIS PAGE TO A FRIEND

PDZRN4

PDZ domain containing ring finger 4

104 Gene Product Result for
Synonyms: LNX4 SAMCAP3L
UniProtKB ID: Q6ZMN7, Q52LY3, Q52LY4, Q6N052, Q8IUU1, Q9NTP7
Gene ID:
Mouse(239618) PDZ domain containing RING finger 4
Rat(315250) PDZ domain containing RING finger 4
Zebrafish(798289) PDZ domain containing ring finger 4
Horse(100053517) PDZ domain containing ring finger 4
domestic cat(101097157) PDZ domain containing ring finger 4
dog(486605) PDZ domain containing ring finger 4
chicken(417787) PDZ domain containing RING finger 4
cow(511963) PDZ domain containing ring finger 4
sheep(101117488) PDZ domain containing ring finger 4
naked mole-rat(101719273) PDZ domain containing ring finger 4
Domestic Rabbit(100357385) PDZ domain containing ring finger 4
domestic guinea pig(100717120) PDZ domain containing ring finger 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013377 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013377 Rosetta Predictions human pricing
NM_001108107 Rosetta Predictions rat pricing
XM_001481302 Rosetta Predictions mouse pricing
XM_992218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344725 predicted 2548
2 SASI_Hs01_00167697 predicted 1496
3 SASI_Hs01_00167698 predicted 2533
4 SASI_Hs01_00167700 predicted 1353
5 SASI_Hs01_00167701 predicted 1052
6 SASI_Hs01_00167704 predicted 540
7 SASI_Hs01_00167705 predicted 393
8 SASI_Hs02_00344726 predicted 881
9 SASI_Hs01_00167706 predicted 238
10 SASI_Hs02_00344727 predicted 2338
11 SASI_Hs01_00167699 predicted 309
12 SASI_Hs01_00167702 predicted 411
13 SASI_Hs01_00167703 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235424 predicted 618
2 SASI_Rn02_00235425 predicted 328
3 SASI_Rn02_00235426 predicted 634
4 SASI_Rn02_00235427 predicted 515
5 SASI_Rn02_00235428 predicted 408
6 SASI_Rn02_00235429 predicted 632
7 SASI_Rn02_00235430 predicted 382
8 SASI_Rn02_00235431 predicted 324
9 SASI_Rn02_00235432 predicted 654
10 SASI_Rn02_00235433 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423544 predicted 1235
2 SASI_Mm02_00423545 predicted 2595
3 SASI_Mm02_00423546 predicted 1974
4 SASI_Mm02_00423547 predicted 601
5 SASI_Mm02_00423548 predicted 1269
6 SASI_Mm02_00423549 predicted 2310
7 SASI_Mm02_00423550 predicted 1845
8 SASI_Mm02_00423551 predicted 807
9 SASI_Mm02_00423552 predicted 2516
10 SASI_Mm02_00423553 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236105 predicted 1232
2 SASI_Mm01_00236108 predicted 605
3 SASI_Mm01_00236109 predicted 1265
4 SASI_Mm01_00236111 predicted 1844
5 SASI_Mm01_00236112 predicted 804
6 SASI_Mm01_00236114 predicted 1021
7 SASI_Mm02_00451025 predicted 1339
8 SASI_Mm02_00451026 predicted 744
9 SASI_Mm02_00451027 predicted 924
10 SASI_Mm02_00451028 predicted 1515
11 SASI_Mm01_00236106 predicted 2733
12 SASI_Mm01_00236107 predicted 2112
13 SASI_Mm01_00236110 predicted 2443
14 SASI_Mm01_00236113 predicted 2661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013377
PDZRN4 MISSION shRNA Bacterial Glycerol Stock
PDZ domain containing ring finger 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2470s1c1
Sequence:CCGGCGAGAGTCCATAATGCCTTCTCTCGAGAGAAGGCATTATGGACTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013377.2-1211s1c1
Sequence:CCGGGAGCCTCGTATCTGGTGAATACTCGAGTATTCACCAGATACGAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-2550s1c1
Sequence:CCGGGCTACCAGTTTCGGTAGAGTACTCGAGTACTCTACCGAAACTGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2471s1c1
Sequence:CCGGGAGAGTCCATAATGCCTTCTTCTCGAGAAGAAGGCATTATGGACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-2969s1c1
Sequence:CCGGCCACATCTTGTCTTACACATACTCGAGTATGTGTAAGACAAGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-3073s1c1
Sequence:CCGGCCATTGTCTTTGTCTCAGTAACTCGAGTTACTGAGACAAAGACAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-3072s1c1
Sequence:CCGGGCCATTGTCTTTGTCTCAGTACTCGAGTACTGAGACAAAGACAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-1520s1c1
Sequence:CCGGCCGGAATTATAACACCAGCATCTCGAGATGCTGGTGTTATAATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2139s1c1
Sequence:CCGGCGTGCCTTAAAGATCAAGGAACTCGAGTTCCTTGATCTTTAAGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013377
PDZRN4 MISSION shRNA shRNA Plasmid DNA
PDZ domain containing ring finger 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2470s1c1
Sequence:CCGGCGAGAGTCCATAATGCCTTCTCTCGAGAGAAGGCATTATGGACTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013377.2-1211s1c1
Sequence:CCGGGAGCCTCGTATCTGGTGAATACTCGAGTATTCACCAGATACGAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-2550s1c1
Sequence:CCGGGCTACCAGTTTCGGTAGAGTACTCGAGTACTCTACCGAAACTGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2471s1c1
Sequence:CCGGGAGAGTCCATAATGCCTTCTTCTCGAGAAGAAGGCATTATGGACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-2969s1c1
Sequence:CCGGCCACATCTTGTCTTACACATACTCGAGTATGTGTAAGACAAGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-3073s1c1
Sequence:CCGGCCATTGTCTTTGTCTCAGTAACTCGAGTTACTGAGACAAAGACAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-3072s1c1
Sequence:CCGGGCCATTGTCTTTGTCTCAGTACTCGAGTACTGAGACAAAGACAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-1520s1c1
Sequence:CCGGCCGGAATTATAACACCAGCATCTCGAGATGCTGGTGTTATAATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2139s1c1
Sequence:CCGGCGTGCCTTAAAGATCAAGGAACTCGAGTTCCTTGATCTTTAAGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013377
PDZRN4 MISSION shRNA Lentiviral Transduction Particles
PDZ domain containing ring finger 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2470s1c1
Sequence:CCGGCGAGAGTCCATAATGCCTTCTCTCGAGAGAAGGCATTATGGACTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013377.2-1211s1c1
Sequence:CCGGGAGCCTCGTATCTGGTGAATACTCGAGTATTCACCAGATACGAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-2550s1c1
Sequence:CCGGGCTACCAGTTTCGGTAGAGTACTCGAGTACTCTACCGAAACTGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2471s1c1
Sequence:CCGGGAGAGTCCATAATGCCTTCTTCTCGAGAAGAAGGCATTATGGACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-2969s1c1
Sequence:CCGGCCACATCTTGTCTTACACATACTCGAGTATGTGTAAGACAAGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-3073s1c1
Sequence:CCGGCCATTGTCTTTGTCTCAGTAACTCGAGTTACTGAGACAAAGACAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013377.2-3072s1c1
Sequence:CCGGGCCATTGTCTTTGTCTCAGTACTCGAGTACTGAGACAAAGACAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-1520s1c1
Sequence:CCGGCCGGAATTATAACACCAGCATCTCGAGATGCTGGTGTTATAATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013377.2-2139s1c1
Sequence:CCGGCGTGCCTTAAAGATCAAGGAACTCGAGTTCCTTGATCTTTAAGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)