EMAIL THIS PAGE TO A FRIEND

PEA15

phosphoprotein enriched in astrocytes 15

180 Gene Product Result for
Synonyms: HMAT1 HUMMAT1H MAT1 MAT1H PEA-15 PED
UniProtKB ID: Q15121, O00511
Gene ID:
Human(8682) Summary: This gene encodes a death effector domain-containing protein, which is a major phosphoprotein in astrocytes, and an endogenous substrate for protein kinase C. Studies using knockout mice suggest that this protein may protect astrocytes from TNF-induced apoptosis. This protein is also overexpressed in type 2 diabetes mellitus, where it may contribute to insulin resistance in glucose uptake. [provided by RefSeq, Sep 2011]
Rat(364052) phosphoprotein enriched in astrocytes 15
dog(610113) phosphoprotein enriched in astrocytes 15
domestic cat(101096131) phosphoprotein enriched in astrocytes 15
domestic guinea pig(100730336) phosphoprotein enriched in astrocytes 15
naked mole-rat(101720718) phosphoprotein enriched in astrocytes 15
cow(510586) phosphoprotein enriched in astrocytes 15
sheep(101118912) phosphoprotein enriched in astrocytes 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503450 Anti-PEA-15 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503451 Anti-PEA-15 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB1306536 ANTI-PEA-15(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
HPA070820 Anti-PEA15 Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
E6658 Anti-PEA15 (102-115) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV48232 Anti-PEA15 antibody produced in rabbit affinity isolated antibody horse, mouse, rabbit, bovine, guinea pig, rat, human
immunohistochemistry, western blot pricing
HPA028356 Anti-PEA15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4503452 Anti-PEA15 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence pricing
SAB4504054 Anti-phospho-PEA-15 (pSer104) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301247 Anti-phospho-PEA-15 (pSer104) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4503967 Anti-phospho-PEA-15 (pSer116) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003768 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083041 MISSION® esiRNA esiRNA human PEA15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003768 Rosetta Predictions human pricing
NM_001013231 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166797 predicted 1068
2 SASI_Hs02_00336258 predicted 502
3 SASI_Hs01_00166798 predicted 416
4 SASI_Hs01_00166799 predicted 342
5 SASI_Hs01_00166800 predicted 602
6 SASI_Hs02_00336259 predicted 431
7 SASI_Hs01_00166801 predicted 1063
8 SASI_Hs01_00166802 predicted 363
9 SASI_Hs01_00166803 predicted 234
10 SASI_Hs01_00166804 predicted 254
11 SASI_Hs01_00166805 predicted 409
12 SASI_Hs01_00166806 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118594 predicted 498
2 SASI_Rn01_00118595 predicted 561
3 SASI_Rn02_00201045 predicted 430
4 SASI_Rn01_00118596 predicted 966
5 SASI_Rn01_00118597 predicted 877
6 SASI_Rn01_00118598 predicted 149
7 SASI_Rn01_00118599 predicted 642
8 SASI_Rn01_00118600 predicted 861
9 SASI_Rn01_00118601 predicted 582
10 SASI_Rn01_00118603 predicted 367
11 SASI_Rn01_00118602 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003768
VALIDATED
PEA15 MISSION shRNA Bacterial Glycerol Stock
phosphoprotein enriched in astrocytes 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003768.2-1827s1c1
Sequence:CCGGGCAGAATCAAATTGCTACATACTCGAGTATGTAGCAATTTGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-344s1c1
Sequence:CCGGAGCCACAACAAGCTGGACAAACTCGAGTTTGTCCAGCTTGTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-370s1c1
Sequence:CCGGCCTCTCCTACATTGAGCACATCTCGAGATGTGCTCAATGTAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003768.2-224s1c1
Sequence:CCGGCTGACCAACAACATCACCCTTCTCGAGAAGGGTGATGTTGTTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-507s1c1
Sequence:CCGGCCAAGAAGTACAAAGACATTACTCGAGTAATGTCTTTGTACTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-341s21c1
Sequence:CCGGAGCCACAACAAGCTGGACAAACTCGAGTTTGTCCAGCTTGTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-537s21c1
Sequence:CCGGCTGAGGAAGAGATCATCAAATCTCGAGATTTGATGATCTCTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003768.3-504s21c1
Sequence:CCGGCCAAGAAGTACAAAGACATTACTCGAGTAATGTCTTTGTACTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-367s21c1
Sequence:CCGGCCTCTCCTACATTGAGCACATCTCGAGATGTGCTCAATGTAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-310s21c1
Sequence:CCGGTACTGGCAGTGCCTGGTTTAGCTCGAGCTAAACCAGGCACTGCCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003768
VALIDATED
PEA15 MISSION shRNA shRNA Plasmid DNA
phosphoprotein enriched in astrocytes 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003768.2-1827s1c1
Sequence:CCGGGCAGAATCAAATTGCTACATACTCGAGTATGTAGCAATTTGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-344s1c1
Sequence:CCGGAGCCACAACAAGCTGGACAAACTCGAGTTTGTCCAGCTTGTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-370s1c1
Sequence:CCGGCCTCTCCTACATTGAGCACATCTCGAGATGTGCTCAATGTAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003768.2-224s1c1
Sequence:CCGGCTGACCAACAACATCACCCTTCTCGAGAAGGGTGATGTTGTTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-507s1c1
Sequence:CCGGCCAAGAAGTACAAAGACATTACTCGAGTAATGTCTTTGTACTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-341s21c1
Sequence:CCGGAGCCACAACAAGCTGGACAAACTCGAGTTTGTCCAGCTTGTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-537s21c1
Sequence:CCGGCTGAGGAAGAGATCATCAAATCTCGAGATTTGATGATCTCTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003768.3-504s21c1
Sequence:CCGGCCAAGAAGTACAAAGACATTACTCGAGTAATGTCTTTGTACTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-367s21c1
Sequence:CCGGCCTCTCCTACATTGAGCACATCTCGAGATGTGCTCAATGTAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-310s21c1
Sequence:CCGGTACTGGCAGTGCCTGGTTTAGCTCGAGCTAAACCAGGCACTGCCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003768
VALIDATED
PEA15 MISSION shRNA Lentiviral Transduction Particles
phosphoprotein enriched in astrocytes 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003768.2-1827s1c1
Sequence:CCGGGCAGAATCAAATTGCTACATACTCGAGTATGTAGCAATTTGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-344s1c1
Sequence:CCGGAGCCACAACAAGCTGGACAAACTCGAGTTTGTCCAGCTTGTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-370s1c1
Sequence:CCGGCCTCTCCTACATTGAGCACATCTCGAGATGTGCTCAATGTAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003768.2-224s1c1
Sequence:CCGGCTGACCAACAACATCACCCTTCTCGAGAAGGGTGATGTTGTTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003768.2-507s1c1
Sequence:CCGGCCAAGAAGTACAAAGACATTACTCGAGTAATGTCTTTGTACTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-341s21c1
Sequence:CCGGAGCCACAACAAGCTGGACAAACTCGAGTTTGTCCAGCTTGTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-537s21c1
Sequence:CCGGCTGAGGAAGAGATCATCAAATCTCGAGATTTGATGATCTCTTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003768.3-504s21c1
Sequence:CCGGCCAAGAAGTACAAAGACATTACTCGAGTAATGTCTTTGTACTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-367s21c1
Sequence:CCGGCCTCTCCTACATTGAGCACATCTCGAGATGTGCTCAATGTAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003768.3-310s21c1
Sequence:CCGGTACTGGCAGTGCCTGGTTTAGCTCGAGCTAAACCAGGCACTGCCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)