EMAIL THIS PAGE TO A FRIEND

PEAK1

107 Gene Product Result for
Synonyms: SGK269
UniProtKB ID: Q9H792, Q6ZS78, Q8NAZ4, Q8NCM3, Q8TEG7
Gene ID:
chicken(100857260) NKF3 kinase family member
dog(487662) NKF3 kinase family member
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_370878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370878 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024776 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049151 MISSION® esiRNA esiRNA human AC107883.6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024776 Rosetta Predictions human pricing
XM_370878 Rosetta Predictions human pricing
XM_935078 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357288 predicted 744
2 SASI_Hs02_00357289 predicted 4295
3 SASI_Hs02_00357290 predicted 2206
4 SASI_Hs02_00357291 predicted 769
5 SASI_Hs02_00357292 predicted 1468
6 SASI_Hs02_00357293 predicted 4118
7 SASI_Hs02_00357294 predicted 1222
8 SASI_Hs02_00357295 predicted 1720
9 SASI_Hs02_00357296 predicted 4289
10 SASI_Hs02_00357297 predicted 3624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249361 predicted 1736
2 SASI_Hs01_00249362 predicted 2003
3 SASI_Hs01_00249363 predicted 799
4 SASI_Hs01_00249364 predicted 1563
5 SASI_Hs01_00249365 predicted 832
6 SASI_Hs01_00249366 predicted 1468
7 SASI_Hs01_00249367 predicted 1730
8 SASI_Hs01_00249368 predicted 1070
9 SASI_Hs01_00249369 predicted 1450
10 SASI_Hs01_00249370 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256288 predicted 1394
2 SASI_Hs01_00256289 predicted 2194
3 SASI_Hs01_00256290 predicted 2542
4 SASI_Hs01_00256291 predicted 414
5 SASI_Hs01_00256292 predicted 2572
6 SASI_Hs01_00256293 predicted 912
7 SASI_Hs01_00256294 predicted 1468
8 SASI_Hs01_00256295 predicted 1124
9 SASI_Hs01_00256296 predicted 427
10 SASI_Hs01_00256297 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370878
VALIDATED
PEAK1 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-5014s1c1
Sequence:CCGGGAAGATCTCTTCCAGACTTTCCTCGAGGAAAGTCTGGAAGAGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-4022s1c1
Sequence:CCGGCGGTTTACTATACTGCTTCATCTCGAGATGAAGCAGTATAGTAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.1-223s1c1
Sequence:CCGGCCCACTATGATAGTGGCAGATCTCGAGATCTGCCACTATCATAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.3-380s1c1
Sequence:CCGGGCCATGTTCCTAAGCCTTATGCTCGAGCATAAGGCTTAGGAACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-3146s1c1
Sequence:CCGGCCCATGAAGTAACAGAGGATTCTCGAGAATCCTCTGTTACTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-1970s1c1
Sequence:CCGGCCACAAGTGTAATAAGCCATACTCGAGTATGGCTTATTACACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-1169s1c1
Sequence:CCGGCCTCTAGTAATAATCAGGATACTCGAGTATCCTGATTATTACTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-2764s1c1
Sequence:CCGGCCTAAGCGCTGGATATCATTTCTCGAGAAATGATATCCAGCGCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-1749s1c1
Sequence:CCGGCCCTGTTAAGTCACCTAATTTCTCGAGAAATTAGGTGACTTAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.3-7399s1c1
Sequence:CCGGGCATAGAACATGTGCACATAACTCGAGTTATGTGCACATGTTCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370878
VALIDATED
PEAK1 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-5014s1c1
Sequence:CCGGGAAGATCTCTTCCAGACTTTCCTCGAGGAAAGTCTGGAAGAGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-4022s1c1
Sequence:CCGGCGGTTTACTATACTGCTTCATCTCGAGATGAAGCAGTATAGTAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.1-223s1c1
Sequence:CCGGCCCACTATGATAGTGGCAGATCTCGAGATCTGCCACTATCATAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.3-380s1c1
Sequence:CCGGGCCATGTTCCTAAGCCTTATGCTCGAGCATAAGGCTTAGGAACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-3146s1c1
Sequence:CCGGCCCATGAAGTAACAGAGGATTCTCGAGAATCCTCTGTTACTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-1970s1c1
Sequence:CCGGCCACAAGTGTAATAAGCCATACTCGAGTATGGCTTATTACACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-1169s1c1
Sequence:CCGGCCTCTAGTAATAATCAGGATACTCGAGTATCCTGATTATTACTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-2764s1c1
Sequence:CCGGCCTAAGCGCTGGATATCATTTCTCGAGAAATGATATCCAGCGCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-1749s1c1
Sequence:CCGGCCCTGTTAAGTCACCTAATTTCTCGAGAAATTAGGTGACTTAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.3-7399s1c1
Sequence:CCGGGCATAGAACATGTGCACATAACTCGAGTTATGTGCACATGTTCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370878
VALIDATED
PEAK1 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-5014s1c1
Sequence:CCGGGAAGATCTCTTCCAGACTTTCCTCGAGGAAAGTCTGGAAGAGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-4022s1c1
Sequence:CCGGCGGTTTACTATACTGCTTCATCTCGAGATGAAGCAGTATAGTAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.1-223s1c1
Sequence:CCGGCCCACTATGATAGTGGCAGATCTCGAGATCTGCCACTATCATAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.3-380s1c1
Sequence:CCGGGCCATGTTCCTAAGCCTTATGCTCGAGCATAAGGCTTAGGAACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-3146s1c1
Sequence:CCGGCCCATGAAGTAACAGAGGATTCTCGAGAATCCTCTGTTACTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-1970s1c1
Sequence:CCGGCCACAAGTGTAATAAGCCATACTCGAGTATGGCTTATTACACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.1-1169s1c1
Sequence:CCGGCCTCTAGTAATAATCAGGATACTCGAGTATCCTGATTATTACTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-2764s1c1
Sequence:CCGGCCTAAGCGCTGGATATCATTTCTCGAGAAATGATATCCAGCGCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370878.3-1749s1c1
Sequence:CCGGCCCTGTTAAGTCACCTAATTTCTCGAGAAATTAGGTGACTTAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_370878.3-7399s1c1
Sequence:CCGGGCATAGAACATGTGCACATAACTCGAGTTATGTGCACATGTTCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024776
PEAK1 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000333865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-4330s21c1
Sequence:CCGGCGGTTTACTATACTGCTTCATCTCGAGATGAAGCAGTATAGTAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-2278s21c1
Sequence:CCGGCCACAAGTGTAATAAGCCATACTCGAGTATGGCTTATTACACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-3454s21c1
Sequence:CCGGCCCATGAAGTAACAGAGGATTCTCGAGAATCCTCTGTTACTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024776
PEAK1 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000333865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-4330s21c1
Sequence:CCGGCGGTTTACTATACTGCTTCATCTCGAGATGAAGCAGTATAGTAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-2278s21c1
Sequence:CCGGCCACAAGTGTAATAAGCCATACTCGAGTATGGCTTATTACACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-3454s21c1
Sequence:CCGGCCCATGAAGTAACAGAGGATTCTCGAGAATCCTCTGTTACTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024776
PEAK1 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000333865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-4330s21c1
Sequence:CCGGCGGTTTACTATACTGCTTCATCTCGAGATGAAGCAGTATAGTAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-2278s21c1
Sequence:CCGGCCACAAGTGTAATAAGCCATACTCGAGTATGGCTTATTACACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024776.2-3454s21c1
Sequence:CCGGCCCATGAAGTAACAGAGGATTCTCGAGAATCCTCTGTTACTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)