EMAIL THIS PAGE TO A FRIEND

PEBP1

phosphatidylethanolamine binding protein 1

60 Gene Product Result for
Synonyms: HCNP HCNPpp PBP PEBP PEBP-1 RKIP
UniProtKB ID: P30086, B2R4S1
Gene ID:
Mouse(23980) phosphatidylethanolamine binding protein 1
Rat(29542) phosphatidylethanolamine binding protein 1
fruit fly(42644) Phosphatidylethanolamine-binding protein 1
Zebrafish(406627) phosphatidylethanolamine binding protein 1
chicken(416990) phosphatidylethanolamine binding protein 1
dog(477501) phosphatidylethanolamine binding protein 1
domestic cat(101092796) phosphatidylethanolamine binding protein 1
domestic guinea pig(100733456) phosphatidylethanolamine binding protein 1
Domestic Rabbit(100008884) phosphatidylethanolamine binding protein 1
naked mole-rat(101708164) phosphatidylethanolamine binding protein 1
cow(431786) phosphatidylethanolamine binding protein 1
sheep(101108954) phosphatidylethanolamine binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002567 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002567 Rosetta Predictions human pricing
NM_017236 Rosetta Predictions rat pricing
NM_018858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226789 predicted 299
2 SASI_Hs01_00226790 predicted 436
3 SASI_Hs02_00334058 predicted 756
4 SASI_Hs01_00226795 predicted 570
5 SASI_Hs01_00226796 predicted 293
6 SASI_Hs02_00334059 predicted 376
7 SASI_Hs01_00226798 predicted 753
8 SASI_Hs02_00334060 predicted 293
9 SASI_Hs02_00334061 predicted 394
10 SASI_Hs02_00334062 predicted 566
11 SASI_Hs01_00226791 predicted 497
12 SASI_Hs01_00226792 predicted 660
13 SASI_Hs01_00226793 predicted 764
14 SASI_Hs01_00226794 predicted 672
15 SASI_Hs01_00226797 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035521 predicted 724
2 SASI_Rn01_00035522 predicted 654
3 SASI_Rn01_00035523 predicted 717
4 SASI_Rn02_00261605 predicted 474
5 SASI_Rn01_00035524 predicted 501
6 SASI_Rn02_00261606 predicted 481
7 SASI_Rn01_00035525 predicted 737
8 SASI_Rn01_00035526 predicted 649
9 SASI_Rn01_00035527 predicted 715
10 SASI_Rn01_00035528 predicted 502
11 SASI_Rn01_00035529 predicted 647
12 SASI_Rn01_00035530 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098670 predicted 897
2 SASI_Mm02_00324215 predicted 420
3 SASI_Mm01_00098671 predicted 796
4 SASI_Mm01_00098672 predicted 468
5 SASI_Mm01_00098675 predicted 659
6 SASI_Mm01_00098676 predicted 277
7 SASI_Mm01_00098677 predicted 540
8 SASI_Mm02_00324216 predicted 599
9 SASI_Mm01_00098678 predicted 742
10 SASI_Mm01_00098679 predicted 310
11 SASI_Mm01_00098673 predicted 453
12 SASI_Mm01_00098674 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018858
VALIDATED
PEBP1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylethanolamine binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-435s21c1
Sequence:CCGGCAGCAACAAGTCTGGAGACAACTCGAGTTGTCTCCAGACTTGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-484s21c1
Sequence:CCGGCGCAAGAAGTATAACCTGGGACTCGAGTCCCAGGTTATACTTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-284s1c1
Sequence:CCGGGTGGTCAACATGAAGGGTAATCTCGAGATTACCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-482s1c1
Sequence:CCGGCGCAAGAAGTATAACCTGGGACTCGAGTCCCAGGTTATACTTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-659s1c1
Sequence:CCGGCCCTCTCATTGGGAGTTCTTACTCGAGTAAGAACTCCCAATGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-373s1c1
Sequence:CCGGCCGCTATGTCTGGCTGGTGTACTCGAGTACACCAGCCAGACATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-433s1c1
Sequence:CCGGCAGCAACAAGTCTGGAGACAACTCGAGTTGTCTCCAGACTTGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018858.2-658s21c1
Sequence:CCGGCCCTCTCATTGGGAGTTCTTACTCGAGTAAGAACTCCCAATGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-375s21c1
Sequence:CCGGCCGCTATGTCTGGCTGGTGTACTCGAGTACACCAGCCAGACATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-286s21c1
Sequence:CCGGGTGGTCAACATGAAGGGTAATCTCGAGATTACCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018858
VALIDATED
PEBP1 MISSION shRNA shRNA Plasmid DNA
phosphatidylethanolamine binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-435s21c1
Sequence:CCGGCAGCAACAAGTCTGGAGACAACTCGAGTTGTCTCCAGACTTGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-484s21c1
Sequence:CCGGCGCAAGAAGTATAACCTGGGACTCGAGTCCCAGGTTATACTTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-284s1c1
Sequence:CCGGGTGGTCAACATGAAGGGTAATCTCGAGATTACCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-482s1c1
Sequence:CCGGCGCAAGAAGTATAACCTGGGACTCGAGTCCCAGGTTATACTTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-659s1c1
Sequence:CCGGCCCTCTCATTGGGAGTTCTTACTCGAGTAAGAACTCCCAATGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-373s1c1
Sequence:CCGGCCGCTATGTCTGGCTGGTGTACTCGAGTACACCAGCCAGACATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-433s1c1
Sequence:CCGGCAGCAACAAGTCTGGAGACAACTCGAGTTGTCTCCAGACTTGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018858.2-658s21c1
Sequence:CCGGCCCTCTCATTGGGAGTTCTTACTCGAGTAAGAACTCCCAATGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-375s21c1
Sequence:CCGGCCGCTATGTCTGGCTGGTGTACTCGAGTACACCAGCCAGACATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-286s21c1
Sequence:CCGGGTGGTCAACATGAAGGGTAATCTCGAGATTACCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018858
VALIDATED
PEBP1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylethanolamine binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-435s21c1
Sequence:CCGGCAGCAACAAGTCTGGAGACAACTCGAGTTGTCTCCAGACTTGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-484s21c1
Sequence:CCGGCGCAAGAAGTATAACCTGGGACTCGAGTCCCAGGTTATACTTCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-284s1c1
Sequence:CCGGGTGGTCAACATGAAGGGTAATCTCGAGATTACCCTTCATGTTGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-482s1c1
Sequence:CCGGCGCAAGAAGTATAACCTGGGACTCGAGTCCCAGGTTATACTTCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-659s1c1
Sequence:CCGGCCCTCTCATTGGGAGTTCTTACTCGAGTAAGAACTCCCAATGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-373s1c1
Sequence:CCGGCCGCTATGTCTGGCTGGTGTACTCGAGTACACCAGCCAGACATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018858.1-433s1c1
Sequence:CCGGCAGCAACAAGTCTGGAGACAACTCGAGTTGTCTCCAGACTTGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018858.2-658s21c1
Sequence:CCGGCCCTCTCATTGGGAGTTCTTACTCGAGTAAGAACTCCCAATGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-375s21c1
Sequence:CCGGCCGCTATGTCTGGCTGGTGTACTCGAGTACACCAGCCAGACATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018858.2-286s21c1
Sequence:CCGGGTGGTCAACATGAAGGGTAATCTCGAGATTACCCTTCATGTTGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002567
VALIDATED
PEBP1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylethanolamine binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-520s1c1
Sequence:CCGGCGAGCAGGACAGGCCGCTAAACTCGAGTTTAGCGGCCTGTCCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-662s1c1
Sequence:CCGGTGGGATGACTATGTGCCCAAACTCGAGTTTGGGCACATAGTCATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-410s1c1
Sequence:CCGGGTGGTCAACATGAAGGGCAATCTCGAGATTGCCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-276s1c1
Sequence:CCGGCCCAGGTTAAGAATAGACCCACTCGAGTGGGTCTATTCTTAACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-586s1c1
Sequence:CCGGCAAATTCAAGGTGGCGTCCTTCTCGAGAAGGACGCCACCTTGAATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-410s21c1
Sequence:CCGGGTGGTCAACATGAAGGGCAATCTCGAGATTGCCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002567.2-662s21c1
Sequence:CCGGTGGGATGACTATGTGCCCAAACTCGAGTTTGGGCACATAGTCATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-520s21c1
Sequence:CCGGCGAGCAGGACAGGCCGCTAAACTCGAGTTTAGCGGCCTGTCCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-175s21c1
Sequence:CCGGGCCCTTGAGCCTGCAAGAAGTCTCGAGACTTCTTGCAGGCTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-688s21c1
Sequence:CCGGCGAGCAGCTGTCTGGGAAGTACTCGAGTACTTCCCAGACAGCTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002567
VALIDATED
PEBP1 MISSION shRNA shRNA Plasmid DNA
phosphatidylethanolamine binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-520s1c1
Sequence:CCGGCGAGCAGGACAGGCCGCTAAACTCGAGTTTAGCGGCCTGTCCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-662s1c1
Sequence:CCGGTGGGATGACTATGTGCCCAAACTCGAGTTTGGGCACATAGTCATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-410s1c1
Sequence:CCGGGTGGTCAACATGAAGGGCAATCTCGAGATTGCCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-276s1c1
Sequence:CCGGCCCAGGTTAAGAATAGACCCACTCGAGTGGGTCTATTCTTAACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-586s1c1
Sequence:CCGGCAAATTCAAGGTGGCGTCCTTCTCGAGAAGGACGCCACCTTGAATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-410s21c1
Sequence:CCGGGTGGTCAACATGAAGGGCAATCTCGAGATTGCCCTTCATGTTGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002567.2-662s21c1
Sequence:CCGGTGGGATGACTATGTGCCCAAACTCGAGTTTGGGCACATAGTCATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-520s21c1
Sequence:CCGGCGAGCAGGACAGGCCGCTAAACTCGAGTTTAGCGGCCTGTCCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-175s21c1
Sequence:CCGGGCCCTTGAGCCTGCAAGAAGTCTCGAGACTTCTTGCAGGCTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-688s21c1
Sequence:CCGGCGAGCAGCTGTCTGGGAAGTACTCGAGTACTTCCCAGACAGCTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002567
VALIDATED
PEBP1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylethanolamine binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-520s1c1
Sequence:CCGGCGAGCAGGACAGGCCGCTAAACTCGAGTTTAGCGGCCTGTCCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-662s1c1
Sequence:CCGGTGGGATGACTATGTGCCCAAACTCGAGTTTGGGCACATAGTCATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-410s1c1
Sequence:CCGGGTGGTCAACATGAAGGGCAATCTCGAGATTGCCCTTCATGTTGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-276s1c1
Sequence:CCGGCCCAGGTTAAGAATAGACCCACTCGAGTGGGTCTATTCTTAACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002567.2-586s1c1
Sequence:CCGGCAAATTCAAGGTGGCGTCCTTCTCGAGAAGGACGCCACCTTGAATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-410s21c1
Sequence:CCGGGTGGTCAACATGAAGGGCAATCTCGAGATTGCCCTTCATGTTGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002567.2-662s21c1
Sequence:CCGGTGGGATGACTATGTGCCCAAACTCGAGTTTGGGCACATAGTCATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-520s21c1
Sequence:CCGGCGAGCAGGACAGGCCGCTAAACTCGAGTTTAGCGGCCTGTCCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-175s21c1
Sequence:CCGGGCCCTTGAGCCTGCAAGAAGTCTCGAGACTTCTTGCAGGCTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002567.2-688s21c1
Sequence:CCGGCGAGCAGCTGTCTGGGAAGTACTCGAGTACTTCCCAGACAGCTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)