EMAIL THIS PAGE TO A FRIEND

PECAM1

platelet/endothelial cell adhesion molecule 1

170 Gene Product Result for
Synonyms: CD31 CD31/EndoCAM GPIIA' PECA1 PECAM-1 endoCAM
Gene ID:
Human(5175) Summary: The protein encoded by this gene is found on the surface of platelets, monocytes, neutrophils, and some types of T-cells, and makes up a large portion of endothelial cell intercellular junctions. The encoded protein is a member of the immunoglobulin superfamily and is likely involved in leukocyte migration, angiogenesis, and integrin activation. [provided by RefSeq, May 2010]
Mouse(18613) platelet/endothelial cell adhesion molecule 1
Rat(29583) platelet/endothelial cell adhesion molecule 1
chicken(771243) platelet/endothelial cell adhesion molecule 1
Horse(100064309) platelet/endothelial cell adhesion molecule 1
domestic cat(101084403) platelet/endothelial cell adhesion molecule 1
dog(610775) platelet/endothelial cell adhesion molecule 1
cow(282303) platelet/endothelial cell adhesion molecule
sheep(100303608) platelet/endothelial cell adhesion molecule 1
domestic guinea pig(100734230) platelet/endothelial cell adhesion molecule 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500059 Anti-CD31 antibody, Rabbit monoclonal clone SP164, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB5500060 Anti-CD31 antibody, Rabbit monoclonal clone SP38, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB1306529 ANTI-CD31(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1302548 ANTI-MOUSE CD31 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution hamster, mouse
western blot pricing
SAB4502167 Anti-PECAM-1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1406243 Anti-PECAM1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA004690 Anti-PECAM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1408616 Anti-PECAM1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
SAB4503968 Anti-phospho-PECAM-1 (pTyr713) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4301491 Anti-phospho-PECAM-1 (pTyr713) antibody produced in rabbit affinity isolated antibody human
western blot pricing
C7714 Monoclonal Anti-CD31 (PECAM-1) antibody produced in mouse clone WM-59, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
P8590 Monoclonal Anti-CD31 (PECAM-1) antibody produced in mouse clone WM-59, purified immunoglobulin, buffered aqueous solution human
immunofluorescence pricing
F8402 Monoclonal Anti-CD31 (PECAM-1)−FITC antibody produced in mouse clone WM-59, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700463 Monoclonal Anti-CD31 antibody produced in mouse clone MEM-05, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700464 Monoclonal Anti-CD31-APC antibody produced in mouse clone MEM-05, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700465 Monoclonal Anti-CD31-Biotin antibody produced in mouse clone MEM-05, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700466 Monoclonal Anti-CD31-FITC antibody produced in mouse clone MEM-05, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700467 Monoclonal Anti-CD31-PE antibody produced in mouse clone MEM-05, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0005175M1 Monoclonal Anti-PECAM1 antibody produced in mouse clone 1D2-1A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1404193 Monoclonal Anti-PECAM1, (C-terminal) antibody produced in mouse clone 4E3-1D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABT1486 Anti-CD31/PECAM-1 Antibody Anti-CD31/PECAM-1 Antibody is an antibody against CD31/PECAM-1. The CD31 antibody is used in Western Blotting and Flow Cytometry applications. pricing
MABF2032M Anti-CD31 (PECAM-1) Antibody, clone MBC 78.1 Anti-CD31 (PECAM-1), clone MBC 78.1, Cat. No. MABF2032, is a mouse monoclonal antibody that detects CD31/PECAM-1 and has been tested for use in Flow Cytometry, Immunocytochemistry, and Immunoprecipitation. pricing
MAB1398Z Anti-PECAM-1 Antibody, clone 2H8, Azide Free Anti-PECAM-1 Antibody, clone 2H8, Azide Free detects level of PECAM-1 & has been published & validated for use in Elecron Microscopy, Flow Cytometry, Immunocytochemistry, Immunofluorescence, Immunohistochemistry, Immunoprecipitation, and Neutralization Assay. pricing
CBL1337 Anti-PECAM-1 Antibody, clone 390 Anti-PECAM-1 Antibody, clone 390 is an antibody against PECAM-1 for use in FC, IH & IP. pricing
CBL1337-I Anti-PECAM-1 Antibody, clone 390 This rat monoclonal Anti-PECAM-1 Antibody, clone 390, Cat. No. CBL1337-I is validated for use in Flow Cytometry, Immunofluorescence, Immunoprecipitation, and Neutralization applications. pricing
CBL1337F Anti-PECAM-1 Antibody, clone 390, FITC conjugated This Anti-PECAM-1 Antibody, clone 390, FITC conjugated is validated for use in FC, IH for the detection of PECAM-1. pricing
MABT533 Anti-PECAM-1 Antibody, clone 4A8.1 This mouse monoclonal Anti-PECAM-1 Antibody, clone 4A8.1, Cat. No. MABT533, is validated for use in Immunohistochemistry (Paraffin) and Western Blotting for the detection of PECAM-1 (CD31). pricing
CBL468F Anti-PECAM-1 Antibody, clone HC1/6, FITC conjugated Detect PECAM-1 using this Anti-PECAM-1 Antibody, clone HC1/6, FITC conjugated validated for use in FC. pricing
CBL468P Anti-PECAM-1 Antibody, clone HC1/6, Phycoerythrin conjugated Anti-PECAM-1 Antibody, clone HC1/6, Phycoerythrin conjugated detects level of PECAM-1 & has been published & validated for use in FC. pricing
MAB2148-C Anti-PECAM-1 Antibody, clone P2B1 (Ascites Free) This Anti-PECAM-1 Antibody, clone P2B1 (Ascites Free) is validated for use in flow cytometry, ICC, IP, IHC, ELISA & immunofluorescence for the detection of PECAM-1. pricing
MAB2148F Anti-PECAM-1 Antibody, clone P2B1, FITC conjugated This Anti-PECAM-1 Antibody, clone P2B1, FITC conjugated is validated for use in ELISA, FC, IC, IH for the detection of PECAM-1. pricing
CBL468 Anti-PECAM-1 Antibody, domains 3-6 of human PECAM-1, clone HC1/6 Anti-PECAM-1 Antibody, domains 3-6 of human PECAM-1, clone HC1/6 is an antibody against PECAM-1 for use in FC, IH, IH(P) & IP. pricing
MAB1393-I Anti-PECAM-1 (CD31) Antibody, clone TLD-3A12 This mouse monoclonal Anti-PECAM-1 (CD31), clone TLD-3A12, Cat. No. MAB1393-I is tested for use in ELISA, Flow Cytometry, Functional Studies, Immunohistochemistry (Paraffin) and Immunohistochemistry, Immunoprecipitation, and Western Blotting, for the detection of CD31/PECAM-1. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000442 Rosetta Predictions human pricing
NM_031591 Rosetta Predictions rat pricing
NM_001032378 Rosetta Predictions mouse pricing
NM_008816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090519 predicted 273
2 SASI_Hs02_00302561 predicted 1768
3 SASI_Hs01_00090522 predicted 2185
4 SASI_Hs01_00090521 predicted 508
5 SASI_Hs01_00090523 predicted 826
6 SASI_Hs01_00090524 predicted 1367
7 SASI_Hs01_00090525 predicted 2382
8 SASI_Hs01_00090526 predicted 1582
9 SASI_Hs01_00090527 predicted 1482
10 SASI_Hs01_00090528 predicted 1060
11 SASI_Hs01_00090520 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103076 predicted 262
2 SASI_Rn01_00103077 predicted 1439
3 SASI_Rn01_00103078 predicted 813
4 SASI_Rn01_00103079 predicted 1490
5 SASI_Rn01_00103080 predicted 2308
6 SASI_Rn02_00264864 predicted 1806
7 SASI_Rn01_00103082 predicted 1991
8 SASI_Rn01_00103083 predicted 1916
9 SASI_Rn01_00103084 predicted 1126
10 SASI_Rn01_00103085 predicted 337
11 SASI_Rn01_00103081 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127742 predicted 958
2 SASI_Mm01_00127743 predicted 1135
3 SASI_Mm01_00127744 predicted 2037
4 SASI_Mm01_00127745 predicted 1602
5 SASI_Mm01_00127746 predicted 1025
6 SASI_Mm01_00127747 predicted 1749
7 SASI_Mm01_00127748 predicted 732
8 SASI_Mm01_00127749 predicted 552
9 SASI_Mm01_00127750 predicted 2039
10 SASI_Mm02_00288165 predicted 1654
11 SASI_Mm01_00127751 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105972 predicted 957
2 SASI_Mm01_00105973 predicted 1132
3 SASI_Mm01_00105974 predicted 2034
4 SASI_Mm01_00105975 predicted 1606
5 SASI_Mm01_00105976 predicted 1021
6 SASI_Mm01_00105977 predicted 1752
7 SASI_Mm01_00105978 predicted 730
8 SASI_Mm01_00105979 predicted 554
9 SASI_Mm01_00105980 predicted 2034
10 SASI_Mm02_00314751 predicted 1647
11 SASI_Mm01_00105981 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000442
VALIDATED
PECAM1 MISSION shRNA Bacterial Glycerol Stock
platelet/endothelial cell adhesion molecule 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000442.2-1740s1c1
Sequence:CCGGGAGAGGACATTGTGCTGCAATCTCGAGATTGCAGCACAATGTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000442.2-946s1c1
Sequence:CCGGGCTCCACATTAAGTGCACCATCTCGAGATGGTGCACTTAATGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_000442.2-2020s1c1
Sequence:CCGGCGGAGTGATCATTGCTCTCTTCTCGAGAAGAGAGCAATGATCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-516s21c1
Sequence:CCGGCTATGACTCAGGGACATATAACTCGAGTTATATGTCCCTGAGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-1515s21c1
Sequence:CCGGCAGTGGAACTTTGCCTATTTCCTCGAGGAAATAGGCAAAGTTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-1347s21c1
Sequence:CCGGGTCGGACAGTGGGACGTATATCTCGAGATATACGTCCCACTGTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000442
VALIDATED
PECAM1 MISSION shRNA shRNA Plasmid DNA
platelet/endothelial cell adhesion molecule 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000442.2-1740s1c1
Sequence:CCGGGAGAGGACATTGTGCTGCAATCTCGAGATTGCAGCACAATGTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000442.2-946s1c1
Sequence:CCGGGCTCCACATTAAGTGCACCATCTCGAGATGGTGCACTTAATGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_000442.2-2020s1c1
Sequence:CCGGCGGAGTGATCATTGCTCTCTTCTCGAGAAGAGAGCAATGATCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-516s21c1
Sequence:CCGGCTATGACTCAGGGACATATAACTCGAGTTATATGTCCCTGAGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-1515s21c1
Sequence:CCGGCAGTGGAACTTTGCCTATTTCCTCGAGGAAATAGGCAAAGTTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-1347s21c1
Sequence:CCGGGTCGGACAGTGGGACGTATATCTCGAGATATACGTCCCACTGTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000442
VALIDATED
PECAM1 MISSION shRNA Lentiviral Transduction Particles
platelet/endothelial cell adhesion molecule 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_000442.2-1740s1c1
Sequence:CCGGGAGAGGACATTGTGCTGCAATCTCGAGATTGCAGCACAATGTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000442.2-946s1c1
Sequence:CCGGGCTCCACATTAAGTGCACCATCTCGAGATGGTGCACTTAATGTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_000442.2-2020s1c1
Sequence:CCGGCGGAGTGATCATTGCTCTCTTCTCGAGAAGAGAGCAATGATCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-516s21c1
Sequence:CCGGCTATGACTCAGGGACATATAACTCGAGTTATATGTCCCTGAGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-1515s21c1
Sequence:CCGGCAGTGGAACTTTGCCTATTTCCTCGAGGAAATAGGCAAAGTTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000442.3-1347s21c1
Sequence:CCGGGTCGGACAGTGGGACGTATATCTCGAGATATACGTCCCACTGTCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008816
PECAM1 MISSION shRNA Bacterial Glycerol Stock
platelet/endothelial cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1909s1c1
Sequence:CCGGCCTTAATAGTTGCAGCCAAATCTCGAGATTTGGCTGCAACTATTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1561s1c1
Sequence:CCGGCGGTGGATGAAGTTGTGATTTCTCGAGAAATCACAACTTCATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1166s1c1
Sequence:CCGGGCAGTATCAGAATTTCAGCAACTCGAGTTGCTGAAATTCTGATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-383s1c1
Sequence:CCGGGAAGTACAAATGCACAGTGATCTCGAGATCACTGTGCATTTGTACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-2011s1c1
Sequence:CCGGGCGAGAAGATTTCTGAGCCTACTCGAGTAGGCTCAGAAATCTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008816
PECAM1 MISSION shRNA shRNA Plasmid DNA
platelet/endothelial cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1909s1c1
Sequence:CCGGCCTTAATAGTTGCAGCCAAATCTCGAGATTTGGCTGCAACTATTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1561s1c1
Sequence:CCGGCGGTGGATGAAGTTGTGATTTCTCGAGAAATCACAACTTCATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1166s1c1
Sequence:CCGGGCAGTATCAGAATTTCAGCAACTCGAGTTGCTGAAATTCTGATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-383s1c1
Sequence:CCGGGAAGTACAAATGCACAGTGATCTCGAGATCACTGTGCATTTGTACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-2011s1c1
Sequence:CCGGGCGAGAAGATTTCTGAGCCTACTCGAGTAGGCTCAGAAATCTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008816
PECAM1 MISSION shRNA Lentiviral Transduction Particles
platelet/endothelial cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1909s1c1
Sequence:CCGGCCTTAATAGTTGCAGCCAAATCTCGAGATTTGGCTGCAACTATTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1561s1c1
Sequence:CCGGCGGTGGATGAAGTTGTGATTTCTCGAGAAATCACAACTTCATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-1166s1c1
Sequence:CCGGGCAGTATCAGAATTTCAGCAACTCGAGTTGCTGAAATTCTGATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-383s1c1
Sequence:CCGGGAAGTACAAATGCACAGTGATCTCGAGATCACTGTGCATTTGTACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008816.1-2011s1c1
Sequence:CCGGGCGAGAAGATTTCTGAGCCTACTCGAGTAGGCTCAGAAATCTTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)