EMAIL THIS PAGE TO A FRIEND

PECR

peroxisomal trans-2-enoyl-CoA reductase

70 Gene Product Result for
Synonyms: DCRRP HPDHASE HSA250303 PVIARL SDR29C1 TERP
Gene ID:
Mouse(111175) peroxisomal trans-2-enoyl-CoA reductase
Rat(113956) peroxisomal trans-2-enoyl-CoA reductase
Zebrafish(550422) peroxisomal trans-2-enoyl-CoA reductase
dog(478901) peroxisomal trans-2-enoyl-CoA reductase
domestic cat(101083284) peroxisomal trans-2-enoyl-CoA reductase
chicken(424224) peroxisomal trans-2-enoyl-CoA reductase
domestic guinea pig(100725791) peroxisomal trans-2-enoyl-CoA reductase
naked mole-rat(101720749) peroxisomal trans-2-enoyl-CoA reductase
cow(617037) peroxisomal trans-2-enoyl-CoA reductase
sheep(101106744) peroxisomal trans-2-enoyl-CoA reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018441 Rosetta Predictions human pricing
NM_133299 Rosetta Predictions rat pricing
NM_023523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011196 predicted 464
2 SASI_Hs01_00011197 predicted 218
3 SASI_Hs01_00011198 predicted 869
4 SASI_Hs01_00011199 predicted 304
5 SASI_Hs01_00011200 predicted 857
6 SASI_Hs01_00011201 predicted 338
7 SASI_Hs01_00011202 predicted 753
8 SASI_Hs01_00011204 predicted 610
9 SASI_Hs01_00011205 predicted 411
10 SASI_Hs02_00351971 predicted 362
11 SASI_Hs01_00011203 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091111 predicted 364
2 SASI_Rn01_00091112 predicted 698
3 SASI_Rn01_00091114 predicted 492
4 SASI_Rn01_00091115 predicted 742
5 SASI_Rn02_00267595 predicted 354
6 SASI_Rn01_00091116 predicted 545
7 SASI_Rn01_00091117 predicted 467
8 SASI_Rn01_00091119 predicted 552
9 SASI_Rn01_00091120 predicted 225
10 SASI_Rn02_00267596 predicted 720
11 SASI_Rn01_00091113 predicted 897
12 SASI_Rn01_00091118 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191772 predicted 690
2 SASI_Mm01_00191773 predicted 367
3 SASI_Mm01_00191774 predicted 345
4 SASI_Mm01_00191775 predicted 882
5 SASI_Mm01_00191776 predicted 561
6 SASI_Mm01_00191777 predicted 726
7 SASI_Mm01_00191778 predicted 838
8 SASI_Mm01_00191779 predicted 550
9 SASI_Mm01_00191780 predicted 459
10 SASI_Mm01_00191781 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018441
VALIDATED
PECR MISSION shRNA Bacterial Glycerol Stock
peroxisomal trans-2-enoyl-CoA reductase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-421s21c1
Sequence:CCGGGCTGAACACATCAGTTCTAAGCTCGAGCTTAGAACTGATGTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-542s21c1
Sequence:CCGGATATCATTGTCCCTACTAAAGCTCGAGCTTTAGTAGGGACAATGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-637s1c1
Sequence:CCGGGCAGTGGAATACGGATCAATTCTCGAGAATTGATCCGTATTCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-750s1c1
Sequence:CCGGCCCGCTAAACGAATTGGTGTTCTCGAGAACACCAATTCGTTTAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018441.2-321s1c1
Sequence:CCGGGAGGTGAATAATTTGGTCAAACTCGAGTTTGACCAAATTATTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018441.2-279s1c1
Sequence:CCGGGCACGAGTCATTCCCATACAACTCGAGTTGTATGGGAATGACTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-605s1c1
Sequence:CCGGCCTCACCAAATCTTTAGCTTTCTCGAGAAAGCTAAAGATTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018441.5-1021s21c1
Sequence:CCGGGCCTTCACATCTTGAGGATATCTCGAGATATCCTCAAGATGTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-872s21c1
Sequence:CCGGGTCTCTATACTCACTCGTATGCTCGAGCATACGAGTGAGTATAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018441
VALIDATED
PECR MISSION shRNA shRNA Plasmid DNA
peroxisomal trans-2-enoyl-CoA reductase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-421s21c1
Sequence:CCGGGCTGAACACATCAGTTCTAAGCTCGAGCTTAGAACTGATGTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-542s21c1
Sequence:CCGGATATCATTGTCCCTACTAAAGCTCGAGCTTTAGTAGGGACAATGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-637s1c1
Sequence:CCGGGCAGTGGAATACGGATCAATTCTCGAGAATTGATCCGTATTCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-750s1c1
Sequence:CCGGCCCGCTAAACGAATTGGTGTTCTCGAGAACACCAATTCGTTTAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018441.2-321s1c1
Sequence:CCGGGAGGTGAATAATTTGGTCAAACTCGAGTTTGACCAAATTATTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018441.2-279s1c1
Sequence:CCGGGCACGAGTCATTCCCATACAACTCGAGTTGTATGGGAATGACTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-605s1c1
Sequence:CCGGCCTCACCAAATCTTTAGCTTTCTCGAGAAAGCTAAAGATTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018441.5-1021s21c1
Sequence:CCGGGCCTTCACATCTTGAGGATATCTCGAGATATCCTCAAGATGTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-872s21c1
Sequence:CCGGGTCTCTATACTCACTCGTATGCTCGAGCATACGAGTGAGTATAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018441
VALIDATED
PECR MISSION shRNA Lentiviral Transduction Particles
peroxisomal trans-2-enoyl-CoA reductase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-421s21c1
Sequence:CCGGGCTGAACACATCAGTTCTAAGCTCGAGCTTAGAACTGATGTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-542s21c1
Sequence:CCGGATATCATTGTCCCTACTAAAGCTCGAGCTTTAGTAGGGACAATGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-637s1c1
Sequence:CCGGGCAGTGGAATACGGATCAATTCTCGAGAATTGATCCGTATTCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-750s1c1
Sequence:CCGGCCCGCTAAACGAATTGGTGTTCTCGAGAACACCAATTCGTTTAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018441.2-321s1c1
Sequence:CCGGGAGGTGAATAATTTGGTCAAACTCGAGTTTGACCAAATTATTCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_018441.2-279s1c1
Sequence:CCGGGCACGAGTCATTCCCATACAACTCGAGTTGTATGGGAATGACTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_018441.2-605s1c1
Sequence:CCGGCCTCACCAAATCTTTAGCTTTCTCGAGAAAGCTAAAGATTTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018441.5-1021s21c1
Sequence:CCGGGCCTTCACATCTTGAGGATATCTCGAGATATCCTCAAGATGTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018441.5-872s21c1
Sequence:CCGGGTCTCTATACTCACTCGTATGCTCGAGCATACGAGTGAGTATAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023523
VALIDATED
PECR MISSION shRNA Bacterial Glycerol Stock
peroxisomal trans-2-enoyl-CoA reductase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-714s1c1
Sequence:CCGGGCTGTTGACAACTATGGCGAACTCGAGTTCGCCATAGTTGTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-539s1c1
Sequence:CCGGCGGAGGGTCGATTGTCAATATCTCGAGATATTGACAATCGACCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023523.3-959s1c1
Sequence:CCGGCAAGAGGATAAAGGAATCTTTCTCGAGAAAGATTCCTTTATCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-380s1c1
Sequence:CCGGGTATGGTAAGATCAACTTCTTCTCGAGAAGAAGTTGATCTTACCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023523.3-345s1c1
Sequence:CCGGGAGGTGAGTTATCTGGTCAAACTCGAGTTTGACCAGATAACTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023523
VALIDATED
PECR MISSION shRNA shRNA Plasmid DNA
peroxisomal trans-2-enoyl-CoA reductase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-714s1c1
Sequence:CCGGGCTGTTGACAACTATGGCGAACTCGAGTTCGCCATAGTTGTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-539s1c1
Sequence:CCGGCGGAGGGTCGATTGTCAATATCTCGAGATATTGACAATCGACCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023523.3-959s1c1
Sequence:CCGGCAAGAGGATAAAGGAATCTTTCTCGAGAAAGATTCCTTTATCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-380s1c1
Sequence:CCGGGTATGGTAAGATCAACTTCTTCTCGAGAAGAAGTTGATCTTACCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023523.3-345s1c1
Sequence:CCGGGAGGTGAGTTATCTGGTCAAACTCGAGTTTGACCAGATAACTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023523
VALIDATED
PECR MISSION shRNA Lentiviral Transduction Particles
peroxisomal trans-2-enoyl-CoA reductase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-714s1c1
Sequence:CCGGGCTGTTGACAACTATGGCGAACTCGAGTTCGCCATAGTTGTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-539s1c1
Sequence:CCGGCGGAGGGTCGATTGTCAATATCTCGAGATATTGACAATCGACCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023523.3-959s1c1
Sequence:CCGGCAAGAGGATAAAGGAATCTTTCTCGAGAAAGATTCCTTTATCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023523.3-380s1c1
Sequence:CCGGGTATGGTAAGATCAACTTCTTCTCGAGAAGAAGTTGATCTTACCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023523.3-345s1c1
Sequence:CCGGGAGGTGAGTTATCTGGTCAAACTCGAGTTTGACCAGATAACTCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)